MirGeneDB

Gene name

Lan-Mir-750

Family name MIR-750 (all species)
MiRBase ID
Paralogues
Orthologues Aae-Mir-750  Asu-Mir-750  Bge-Mir-750  Cgi-Mir-750  Cte-Mir-750  Dpu-Mir-750  Efe-Mir-750-P1  Efe-Mir-750-P2  Efe-Mir-750-P3  Hme-Mir-750  Isc-Mir-750  Lgi-Mir-750  Tca-Mir-750 
Node of Origin (gene) Protostomia
Node of Origin (family) Protostomia
Genome context
(LinAna_1.0)
LFEI01000307: 97855-97918 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAUUUGAACUAUUAGGUGCUCCUAGUUGAGUUGGAAGAUUAGGGCUGACAGUUAUAUGUAAGCUUGGUGCCAGAUCUAACUCUUCCAGCUCAGGUUGGAGUCACAGUUAACAACAUUCAAAU
Get precursor sequence
Structure
        10         20         30        40         50        60 
UGCAUUUGAACUAUUAG-   -    UAG             -|   GG   A AGUUAUAUG 
                  GUG CUCC   UUGAGUUGGAAGA UUAG  CUG C         \
                  CAC GAGG   GACUCGACCUUCU AAUC  GAC G         U
UAAACUUACAACAAUUGA   U    UUG             C^   UA   C UGGUUCGAA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To To
Star sequence

Lan-Mir-750_5p*

MirBase accessionNone
Sequence
0- AGUUGGAAGAUUAGGGCUGAC -21
Get sequence
Mature sequence

Lan-Mir-750_3p

MirBase accessionNone
Sequence
41- CCAGAUCUAACUCUUCCAGCUCA -64
Get sequence
Seed sequenceCAGAUCU