MirGeneDB

Gene name

Lan-Mir-2001-P2

Family name MIR-2001 (all species)
MiRBase ID
Paralogues Lan-Mir-2001-P1 
Orthologues Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (gene) L. anatina
Node of Origin (family) Bilateria
Genome context
(LinAna_1.0)
LFEI01000195: 453230-453288 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACAACAAAAACAGUACCCAUGAUCUGGUCGUUGUGACCGUUAUAAUGGGCAUGGACAUAUGAACAAUGCUCUUUAUAACGCUCAUAACCGACAGACAUGUCUGACACAUCGACCUCAGA
Get precursor sequence
Structure
        10           20        30         40        50         
ACAACAAAAACAGUACC---|   A    G   -      C        U     UGGACAU 
                    CAUG UCUG UCG UUGUGA CGUUAUAA GGGCA       \
                    GUAC AGAC AGC AAUACU GCAAUAUU CUCGU       A
AGACUCCAGCUACACAGUCU^   -    -   C      C        U     AACAAGU 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To To
Mature sequence

Lan-Mir-2001-P2_5p (predicted)

MirBase accessionNone
Sequence
0- UUGUGACCGUUAUAAUGGGCA -21
Get sequence
Seed sequenceUGUGACC
Star sequence

Lan-Mir-2001-P2_3p* (predicted)

MirBase accessionNone
Sequence
38- CUCUUUAUAACGCUCAUAACC -59
Get sequence