MirGeneDB

Gene name

Lan-Mir-2-o74

Family name MIR-2 (all species)
MiRBase ID
Paralogues Lan-Mir-2-o71  Lan-Mir-2-o72a  Lan-Mir-2-o72b  Lan-Mir-2-o73  Lan-Mir-2-o75  Lan-Mir-2-o76  Lan-Mir-2-o77a  Lan-Mir-2-o77b  Lan-Mir-2-o78  Lan-Mir-2-o79 
Orthologues
Node of Origin (gene) L. anatina
Node of Origin (family) Protostomia
Genome context
(LinAna_1.0)
LFEI01000397: 182869-182928 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGAGUGAAGAUUGCGAUUGCUGAGCUGAGUUUGUCAAAGUGGCUGUGAUUUGGUUGAAAUUAACGCAUAUCACAGCCCGCUUUGACGAGCUUACGGCAACACGACACAACCAGCUAAGCU
Get precursor sequence
Structure
        10             20        30        40         50         
UGAGUGAAGAUUGCGAU-----|    AGC                 -       U  GUUGAA 
                      UGCUG   UGAGUUUGUCAAAGUGG CUGUGAU UG      \
                      ACGGC   AUUCGAGCAGUUUCGCC GACACUA AC      A
UCGAAUCGACCAACACAGCACA^    ---                 C       U  GCAAUU 
.       110       100           90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To To
Star sequence

Lan-Mir-2-o74_5p* (predicted)

MirBase accessionNone
Sequence
0- UUGUCAAAGUGGCUGUGAUUUG -22
Get sequence
Mature sequence

Lan-Mir-2-o74_3p

MirBase accessionNone
Sequence
37- UAUCACAGCCCGCUUUGACGAGC -60
Get sequence
Seed sequenceAUCACAG