MirGeneDB

Gene name

Lan-Mir-193-P2i

Family name MIR-193 (all species)
MiRBase ID
Paralogues Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lan-Mir-193-P2j 
Orthologues Bge-Mir-193-P2  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cgi-Mir-193-P2  Cte-Mir-193-P2  Hme-Mir-193-P2  Lgi-Mir-193-P2  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Sko-Mir-193-P2  Tca-Mir-193-P2 
Node of Origin (gene) L. anatina
Node of Origin (family) Bilateria
Genome context
(LinAna_1.0)
LFEI01000500: 137739-137796 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAUGAGGGUUAGAGAGACGCAAGUAUAUUUGGGAUUUCGUGGGACAUUCUGUGAGAUAGAAAUGACAAUGCCCUGCGAAAUCCUAAACGUGCAUGUACGACACUCCUUUCACACGCA
Get precursor sequence
Structure
        10          20        30        40        50         
AAAUGAGGGUUAGAGAGAC--|  A   UA            UG  A   UC   GAGAU 
                     GCA GUA  UUUGGGAUUUCG  GG CAU  UGU     A
                     UGU CGU  AAAUCCUAAAGC  CC GUA  ACA     G
ACGCACACUUUCCUCACAGCA^  A   GC            GU  C   --   GUAAA 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To To
Star sequence

Lan-Mir-193-P2i_5p*

MirBase accessionNone
Sequence
0- UGGGAUUUCGUGGGACAUUCUGUG -24
Get sequence
Mature sequence

Lan-Mir-193-P2i_3p

MirBase accessionNone
Sequence
36- CAAUGCCCUGCGAAAUCCUAAA -58
Get sequence
Seed sequenceAAUGCCC