MirGeneDB

MirGeneDB ID

Lan-Mir-193-P1j

Family name MIR-193 (all species)
Seed ACUGGCC
Species Lingula (Lingula anatina)
MiRBase ID
Paralogues Lan-Mir-193-P1i  Lan-Mir-193-P2i  Lan-Mir-193-P2j 
Orthologues Aae-Mir-193-P1  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cgi-Mir-193-P1  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dpu-Mir-193-P1  Hme-Mir-193-P1  Isc-Mir-193-P1  Lgi-Mir-193-P1  Pmi-Mir-193-P1  Tca-Mir-193-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(LinAna_1.0)
LFEI01000010: 32734-32794 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AACAGUACGGGCUACACGUCCUCUCUCAUCAGGGAGUUUGCUCGCCAUGCUUAUGGCUCUGAAUCUAUAAACUGGCCUGCAAAAUCCCUUCUGACGUGGGGACAUUGAGCAAACCCGUGAU
Get precursor sequence
Structure
        10         20         30        40        50          
AACAGUACGGGCUACAC-      UC-|  UC     G     UC    UGCUUAUGGCUC 
                  GUCCUC   UCA  AGGGA UUUGC  GCCA            \
                  CAGGGG   AGU  UCCCU AAACG  CGGU            U
UAGUGCCCAAACGAGUUA      UGC^  CU     A     UC    CAAAUAUCUAAG 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To To
Star sequence

Lan-Mir-193-P1j_5p* (predicted)

MirBase accessionNone
Sequence
0- AGGGAGUUUGCUCGCCAUGCUUA -23
Get sequence
Mature sequence

Lan-Mir-193-P1j_3p

MirBase accessionNone
Sequence
39- AACUGGCCUGCAAAAUCCCUUC -61
Get sequence