MirGeneDB

Gene name

Isc-Mir-216-P1

Family name MIR-216 (all species)
MiRBase ID isc-mir-5307
Paralogues
Orthologues Aca-Mir-216-P1a  Aca-Mir-216-P1b  Ami-Mir-216-P1a  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cli-Mir-216-P1b  Cpi-Mir-216-P1a  Cpi-Mir-216-P1b  Cpo-Mir-216-P1a  Cpo-Mir-216-P1b  Cte-Mir-216-P1c  Cte-Mir-216-P1d  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1a  Ete-Mir-216-P1b  Gga-Mir-216-P1a  Gga-Mir-216-P1b  Hsa-Mir-216-P1a  Hsa-Mir-216-P1b  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mdo-Mir-216-P1b  Mml-Mir-216-P1a  Mml-Mir-216-P1b  Mmu-Mir-216-P1a  Mmu-Mir-216-P1b  Ocu-Mir-216-P1a  Ocu-Mir-216-P1b  Rno-Mir-216-P1a  Rno-Mir-216-P1b  Sha-Mir-216-P1a  Sha-Mir-216-P1b  Tca-Mir-216-P1  Xtr-Mir-216-P1a 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS942119: 46335-46394 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1)
Mir-12 DS942119: 45760-45819 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GACCCCCUGCACUGGCGCCUUCCGGAGGCCUAAUCUCAUUUGGUAUCUCUGGGGGGCUGAGCGACGUCCAGGGUACCAGAUGAGAUGGGGUCUCGGGGAGCACCUCCAUGCAUGACGCAG
Get precursor sequence
Structure
        10          20        30        40        50          
GACCCCCUGCACUGGCGC--|    G       A               U     GGGCUG 
                    CUUCC GAGGCCU AUCUCAUUUGGUAUC CUGGG      \
                    GAGGG CUCUGGG UAGAGUAGACCAUGG GACCU      A
GACGCAGUACGUACCUCCAC^    G       G               -     GCAGCG 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-216-P1_5p

MirBase accessionMIMAT0021377
Sequence
0- UAAUCUCAUUUGGUAUCUCUGGG -23
Get sequence
Seed sequenceAAUCUCA
Star sequence

Isc-Mir-216-P1_3p* (predicted)

MirBase accessionNone
Sequence
38- CAGGGUACCAGAUGAGAUGGGG -60
Get sequence