
Gene name


Family name MIR-29 (all species)
Species Human (Homo sapiens)
MiRBase ID hsa-mir-29c
Paralogues Hsa-Mir-29-P1a  Hsa-Mir-29-P2a  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
chr1: 207801865-207801922 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b-v1 chr1: 207802450-207802513 [-] UCSC Ensembl
Mir-29-P2b-v2 chr1: 207802451-207802512 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10            20         30        40        50         
GCACCACUGGCCCAUCU----      -| GGC           UCC       C   GUCUG 
                     CUUACA CA   UGACCGAUUUC   UGGUGUU AGA     \
                     GGAUGU GU   AUUGGCUAAAG   ACCACGA UCU     U
AAGCUCCGACGACGAAAAGGG      A^ ---           UUU       -   GUUUU 
      110       100        90           80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Bo Bo Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence


MirBase accessionMIMAT0004673
Get sequence
Validated targets microrna.org: MIMAT0004673
TargetScanVert: hsa-miR-29c-5p
TargetMiner: hsa-miR-29c-5p
miRDB: MIMAT0004673
Annotation deviationYes (sequence)
Mature sequence


MirBase accessionMIMAT0000681
Get sequence
Seed sequenceAGCACCA
Validated targets microrna.org: MIMAT0000681
TargetScanVert: hsa-miR-29c-3p
TargetMiner: hsa-miR-29c-3p
miRDB: MIMAT0000681
Annotation deviationYes (coordinates)