MirGeneDB

MirGeneDB ID

Hme-Novel-5-P5

Family name HME-NOVEL-5 (all species)
Seed UUGCCUU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues Hme-Novel-5-P1  Hme-Novel-5-P2  Hme-Novel-5-P3a  Hme-Novel-5-P3b  Hme-Novel-5-P4 
Orthologues
Node of Origin (locus) H. melpomene
Node of Origin (family) H. melpomene
Genome context
(Hmel_1)
HE671980: 160985-161040 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAAGUGAAAUCUUUGAUGUGACGGCAGAUGGGAGACUACCUAAUUGCAAGGUGUAUCUAUCGACUUUGCCUUUAGUUACUUUCCGAUCUUUCAGUACACAUGUCUAUAGAUGAAGU
Get precursor sequence
Structure
        10          20        30        40        50       
UAAGUGAAAUCUUUGAU--|  AC  C    G     C  C    UU       GUAU 
                   GUG  GG AGAU GGAGA UA CUAA  GCAAGGU    C
                   CAU  CU UCUA CCUUU AU GAUU  CGUUUCA    U
UGAAGUAGAUAUCUGUACA^  GA  U    G     C  U    UC       GCUA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Novel-5-P5_5p*

MirBase accessionNone
Sequence
0- GGAGACUACCUAAUUGCAAGGU -22
Get sequence
Mature sequence

Hme-Novel-5-P5_3p

MirBase accessionNone
Sequence
34- UUUGCCUUUAGUUACUUUCCGA -56
Get sequence