MirGeneDB

MirGeneDB ID

Hme-Novel-5-P3a

Family name HME-NOVEL-5 (all species)
Seed UUGCCUU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues Hme-Novel-5-P1  Hme-Novel-5-P2  Hme-Novel-5-P3b  Hme-Novel-5-P4  Hme-Novel-5-P5 
Orthologues
Node of Origin (locus) H. melpomene
Node of Origin (family) H. melpomene
Genome context
(Hmel_1)
HE671980: 160606-160661 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAAAUUAAAUAUUUGAUGUGACGGCAGAUGGGAGACUACCUAAUUGCAAGGUGUAUCUAUCGACUUUGCCUUUAGUUAGUUUCCGGUCUUUCAGUGCAUAUGUCUACAGGAUGAAG
Get precursor sequence
Structure
        10          20        30        40        50       
UAAAUUAAAUAUUUGAU--|  AC  C    G        C    UU       GUAU 
                   GUG  GG AGAU GGAGACUA CUAA  GCAAGGU    C
                   CGU  CU UCUG CCUUUGAU GAUU  CGUUUCA    U
GAAGUAGGACAUCUGUAUA^  GA  U    G        U    UC       GCUA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Novel-5-P3a_5p*

MirBase accessionNone
Sequence
0- GGAGACUACCUAAUUGCAAGGU -22
Get sequence
Mature sequence

Hme-Novel-5-P3a_3p

MirBase accessionNone
Sequence
34- UUUGCCUUUAGUUAGUUUCCGG -56
Get sequence