MirGeneDB

Gene name

Hme-Novel-4

Family name HME-NOVEL-4 (all species)
MiRBase ID
Paralogues
Orthologues
Node of Origin (gene) H. melpomene
Node of Origin (family) H. melpomene
Genome context
(Hmel_1)
HE671687: 151159-151219 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAUAUCAUUUGUGUUGAUUCUGAUUACUGAUGAUGAUCAUGAUGAUGAAUACAUAUUAAGUGUUUAUAUUCCUCUUCAUAAUCAUCAUCGUCAUCAUCAACCUGUCUUCAUCCACCGCUG
Get precursor sequence
Structure
        10        20           30        40        50          
AAAUAUCAUUUGUGUUGAUUC---|   U  U         C    U  U     CAUAUUA 
                        UGAU AC GAUGAUGAU AUGA GA GAAUA       \
                        ACUA UG CUACUACUA UACU CU CUUAU       A
GUCGCCACCUACUUCUGUCCAACU^   C  -         A    U  C     AUUUGUG 
 .       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Novel-4_5p

MirBase accessionNone
Sequence
0- AUGAUGAUCAUGAUGAUGAAUA -22
Get sequence
Seed sequenceUGAUGAU
Co-mature sequence

Hme-Novel-4_3p

MirBase accessionNone
Sequence
39- UUCCUCUUCAUAAUCAUCAUCG -61
Get sequence
Seed sequenceUCCUCUU