MirGeneDB

MirGeneDB ID

Hme-Mir-989-P2

Family name MIR-989 (all species)
Seed GUGAUGU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues Hme-Mir-989-P1 
Orthologues Aae-Mir-989  Dan-Mir-989  Dme-Mir-989  Dmo-Mir-989  Tca-Mir-989 
Node of Origin (locus) H. melpomene
Node of Origin (family) Endopterygota
Genome context
(Hmel_1)
FARY01123984.1: 1726-1785 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCAUUACCUCACAGUCACGUGGUCUCUGCGGUACAACGUGUGAUGUGACGUAGUGGAAGUCUCGACCUGGAUAUACAACAUUAGCUUAG
Get precursor sequence
Structure
        10        20        30          40         50         
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG--       C     GU-|    GGUCUCU 
                                 CCAUUAC UCACA   CACGU       \
                                 GGUGAUG AGUGU   GUGCA       G
GAUUCGAUUACAACAUAUAGGUCCAGCUCUGAA       C     AGU^    ACAUGGC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-989-P2_5p*

MirBase accessionNone
Sequence
0- GCCAUUACCUCACAGUCACGUG -22
Get sequence
Mature sequence

Hme-Mir-989-P2_3p

MirBase accessionNone
Sequence
39- UGUGAUGUGACGUAGUGGAAG -60
Get sequence