MirGeneDB

Gene name

Hme-Mir-989-P2

Family name MIR-989 (all species)
MiRBase ID
Paralogues Hme-Mir-989-P1 
Orthologues Aae-Mir-989  Dan-Mir-989  Dme-Mir-989  Dmo-Mir-989  Tca-Mir-989 
Node of Origin (gene) H. melpomene
Node of Origin (family) Endopterygota
Genome context
(Hmel_1)
FARY01123984.1: 1726-1785 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAUUACCUCACAGUCACGUGGUCUCUGCGGUACAACGUGUGAUGUGACGUAGUGGAAG
Get precursor sequence
Structure
          10         20         
G--       C     GU-     G  -| C 
   CCAUUAC UCACA   CACGU GU CU U
   GGUGAUG AGUGU   GUGCA CA GG G
GAA       C     AGU     A  U^ C 
.        50        40        30
Deep sequencing
CommentNot in assembly but in trace archive.
3' NTU No
MotifsNo
Star sequence

Hme-Mir-989-P2_5p*

MirBase accessionNone
Sequence
0- GCCAUUACCUCACAGUCACGUG -22
Get sequence
Mature sequence

Hme-Mir-989-P2_3p

MirBase accessionNone
Sequence
39- UGUGAUGUGACGUAGUGGAAG -60
Get sequence
Seed sequenceGUGAUGU