MirGeneDB

MirGeneDB ID

Hme-Mir-279-o34

Family name MIR-279 (all species)
Seed GACUAGA
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-279d
Paralogues Hme-Mir-279-o31  Hme-Mir-279-o32  Hme-Mir-279-o33 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) H. melpomene
Node of Origin (family) Protostomia
Genome context
(Hmel_1)
HE670979: 4653-4713 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o34)
Mir-279-o34 HE670979: 4653-4713 [-] Ensembl
Mir-279-o32 HE670979: 5122-5178 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUGGGUAGAUUUGACUUGAUGAUCUUUGUGGGCGAGUUUGCUUCUGGUUCAUGUCAAAUUAACAUCAUGACUAGAUCCAUACUCGUCUGCAGCCAUCAACUCAAUCAACAUUAAUUAAAU
Get precursor sequence
Structure
        10             20        30        40        50        60
AAUGGGUAGAUUUGACU-----|    AUCU   UG       U  CU      U    UCAAA 
                      UGAUG    UUG  GGCGAGU UG  UCUGGU CAUG     U
                      ACUAC    GAC  CUGCUCA AC  AGAUCA GUAC     U
UAAAUUAAUUACAACUAACUCA^    C---   GU       U  CU      -    UACAA 
 .       110       100           90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-279-o34_5p*

MirBase accessionNone
Sequence
0- GGGCGAGUUUGCUUCUGGUUCAUG -24
Get sequence
Mature sequence

Hme-Mir-279-o34_3p

MirBase accessionMIMAT0024965
Sequence
38- UGACUAGAUCCAUACUCGUCUGC -61
Get sequence