MirGeneDB

MirGeneDB ID

Hme-Mir-2766-P1

Family name MIR-2766 (all species)
Seed CAGUCUU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues Hme-Mir-2766-P2 
Orthologues
Node of Origin (locus) H. melpomene
Node of Origin (family) H. melpomene
Genome context
(Hmel_1)
HE670389: 111848-111906 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGAAAGAAGAUACUUUCACUCGACUUGCCCAUCAUUUGGCUCGACUGUCACUGUCCAAGUUCUUGUCAGUCUUGUCGAAUGGUGGGUCUGUUCUGUGAUCACUCAUCAAAAAAGAAC
Get precursor sequence
Structure
        10          20        30        40        50         
GAAGAAAGAAGAUACUU--|   UC   UU              UC     U  CUGUCC 
                   UCAC  GAC  GCCCAUCAUUUGGC  GACUG CA      \
                   AGUG  UUG  UGGGUGGUAAGCUG  CUGAC GU      A
CAAGAAAAAACUACUCACU^   UC   UC              UU     U  UCUUGA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-2766-P1_5p*

MirBase accessionNone
Sequence
0- CCAUCAUUUGGCUCGACUGUCA -22
Get sequence
Mature sequence

Hme-Mir-2766-P1_3p

MirBase accessionNone
Sequence
37- UCAGUCUUGUCGAAUGGUGGGU -59
Get sequence