MirGeneDB

Gene name

Gga-Mir-92-P4

Family name MIR-92 (all species)
MiRBase ID gga-mir-363
Paralogues Gga-Mir-92-P1a  Gga-Mir-92-P1b  Gga-Mir-92-P5 
Orthologues Aca-Mir-92-P4  Asu-Mir-92  Bfl-Mir-92-o4  Bta-Mir-92-P4  Cel-Mir-92  Cfa-Mir-92-P4  Cli-Mir-92-P4  Cpi-Mir-92-P4  Cpo-Mir-92-P4  Dno-Mir-92-P4  Dre-Mir-92-P4a  Ete-Mir-92-P4  Hsa-Mir-92-P4  Isc-Mir-92  Mdo-Mir-92-P4  Mml-Mir-92-P4  Mmu-Mir-92-P4  Ocu-Mir-92-P4  Rno-Mir-92-P4  Sha-Mir-92-P4  Tgu-Mir-92-P4  Xtr-Mir-92-P4 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
4: 3994429-3994493 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P4)
Mir-92-P1b 4: 3994569-3994630 [-] UCSC Ensembl
Mir-19-P2b 4: 3994717-3994776 [-] UCSC Ensembl
Mir-17-P3b 4: 3994853-3994913 [-] UCSC Ensembl
Mir-17-P2b 4: 3995025-3995089 [-] UCSC Ensembl
Mir-17-P1b 4: 3995161-3995218 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAGCACGGUAAGCUUUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUUUAGUAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACCGCAAGACCUUCAUCCGCUGACACAGC
Get precursor sequence
Structure
        10          20        30        40        50        60  
UCAGCACGGUAAGCUUU--|      U   GU         CA  A         GAUUAGUU 
                   GUUUUGC GUU  CGGGUGGAU  CG UGCAAUUUU        U
                   CAGAACG CAA  GUCUACCUA  GC ACGUUAAAA        A
CGACACAGUCGCCUACUUC^      C   AU         UG  -         AGAGGAUG 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-92-P4_5p*

MirBase accessionMIMAT0037553
Sequence
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
Mature sequence

Gga-Mir-92-P4_3p

MirBase accessionMIMAT0037554
Sequence
43- AAUUGCACGGUAUCCAUCUGUA -65
Get sequence
Seed sequenceAUUGCAC