MirGeneDB

Gene name

Gga-Mir-92-P1b

Family name MIR-92 (all species)
MiRBase ID gga-mir-92-2
Paralogues Gga-Mir-92-P1a  Gga-Mir-92-P4  Gga-Mir-92-P5 
Orthologues Aca-Mir-92-P1b  Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1b  Cel-Mir-92  Cfa-Mir-92-P1b  Cli-Mir-92-P1b  Cpi-Mir-92-P1b  Cpo-Mir-92-P1b  Dno-Mir-92-P1b  Ete-Mir-92-P1b  Hsa-Mir-92-P1b  Isc-Mir-92  Mdo-Mir-92-P1b  Mml-Mir-92-P1b  Mmu-Mir-92-P1b  Ocu-Mir-92-P1b  Rno-Mir-92-P1b  Sha-Mir-92-P1b  Tgu-Mir-92-P1b  Xtr-Mir-92-P1b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
4: 3994569-3994630 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1b)
Mir-92-P4 4: 3994429-3994493 [-] UCSC Ensembl
Mir-19-P2b 4: 3994717-3994776 [-] UCSC Ensembl
Mir-17-P3b 4: 3994853-3994913 [-] UCSC Ensembl
Mir-17-P2b 4: 3995025-3995089 [-] UCSC Ensembl
Mir-17-P1b 4: 3995161-3995218 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCGAAGAUGCCUUGCGCUGGUUCCUCCGUGGGUGGGGAUUUGUUGCAUUACUUGUAGCUGUGUGUAGAGUAUUGCACUUGUCCCGGCCUGUGGAGGAAAGGAGGACUGGUCUUCAGGCUGC
Get precursor sequence
Structure
        10           20        30        40        50        60 
UCCGAAGAUGCCUUGCG---| GG        UG   G     UU  U   U    UGUAGCU 
                    CU  UUCCUCCG  GGU GGGAU  GU GCA UACU       \
                    GG  AAGGAGGU  CCG CCCUG  CA CGU AUGA       G
CGUCGGACUUCUGGUCAGGA^ A-        GU   G     UU  -   U    GAUGUGU 
120       110       100         90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site on the 5p arm +2 relative as well as a second Dicer site +1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-92-P1b_5p*

MirBase accessionNone
Sequence
0- GGGUGGGGAUUUGUUGCAUUACU -23
Get sequence
Mature sequence

Gga-Mir-92-P1b_3p

MirBase accessionMIMAT0001109
Sequence
40- UAUUGCACUUGUCCCGGCCUGU -62
Get sequence
Seed sequenceAUUGCAC