MirGeneDB

MirGeneDB ID

Gga-Mir-458-as

Family name MIR-458 (all species)
Seed UAGCUCU
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-458b
Paralogues Gga-Mir-458 
Orthologues Aca-Mir-458  Ami-Mir-458  Cli-Mir-458  Cli-Mir-458-as  Cpi-Mir-458  Dre-Mir-458  Oan-Mir-458  Tgu-Mir-458  Xtr-Mir-458 
Node of Origin (locus) Neognathae
Node of Origin (family) Osteichthyes
Genome context
(galGal5)
13: 8233342-8233399 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-458-as)
Mir-458 13: 8233340-8233397 [-] UCSC Ensembl
Mir-458-as 13: 8233342-8233399 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUAGAUGCUGUUUUUCCAGUACAUAUGGCAGUACCAUUCAAAGAGCUAUGACAAUGACGCUGUUUAUAGCUCUGAAAAUGGCGCUGCCAUCUGCACCACGGCCGCGGCUCUGCUCCC
Get precursor sequence
Structure
        10          20        30        40        50        
CAUAGAUGCUGUUUUUCCA--| A  U       UA     CAA          CAAUG 
                     GU CA AUGGCAG  CCAUU   AGAGCUAUGA     A
                     CA GU UACCGUC  GGUAA   UCUCGAUAUU     C
CCCUCGUCUCGGCGCCGGCAC^ C  C       GC     AAG          UGUCG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-458-as_5p*

MirBase accessionMIMAT0025830
Sequence
0- AGUACCAUUCAAAGAGCUAUGA -22
Get sequence
Validated targets TargetScanVert: gga-miR-458b-5p
miRDB: MIMAT0025830
Mature sequence

Gga-Mir-458-as_3p

MirBase accessionMIMAT0025831
Sequence
36- AUAGCUCUGAAAAUGGCGCUGC -58
Get sequence
Validated targets TargetScanVert: gga-miR-458b-3p
miRDB: MIMAT0025831