
Gene name


Family name MIR-30 (all species)
MiRBase ID gga-mir-30d
Paralogues Gga-Mir-30-P1a  Gga-Mir-30-P1b  Gga-Mir-30-P2a  Gga-Mir-30-P2b  Gga-Mir-30-P2c 
Orthologues Aca-Mir-30-P1c  Ami-Mir-30-P1c  Bta-Mir-30-P1c  Cfa-Mir-30-P1c  Cli-Mir-30-P1c  Cpi-Mir-30-P1c  Cpo-Mir-30-P1c  Dno-Mir-30-P1c  Dre-Mir-30-P1c  Ete-Mir-30-P1c  Hsa-Mir-30-P1c  Mdo-Mir-30-P1c  Mml-Mir-30-P1c  Mmu-Mir-30-P1c  Ocu-Mir-30-P1c  Rno-Mir-30-P1c  Sha-Mir-30-P1c  Tgu-Mir-30-P1c  Xtr-Mir-30-P1c 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
2: 142761260-142761318 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-30-P1c)
Mir-30-P2c 2: 142757727-142757786 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50          
CACCUGCAGUGAUGUAUA--|     UGU   U         CCC           GUAGC 
                    GUAGUC   UGC GUAAACAUC   GACUGGAAGCU     \
                    UAUCGG   ACG CGUUUGUAG   CUGACUUUCGA     A
GGAGGACUACGACAGGUCCA^     UCC   U         A--           GUUCG 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence


MirBase accessionMIMAT0001129
Get sequence
Seed sequenceGUAAACA
Validated targets TargetScanVert: gga-miR-30d
miRDB: MIMAT0001129
Star sequence


MirBase accessionNone
Get sequence