MirGeneDB

MirGeneDB ID

Gga-Mir-30-P1c

Family name MIR-30 (all species)
Seed GUAAACA
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-30d
Paralogues Gga-Mir-30-P1a  Gga-Mir-30-P1b  Gga-Mir-30-P2a  Gga-Mir-30-P2b  Gga-Mir-30-P2c 
Orthologues Aca-Mir-30-P1c  Ami-Mir-30-P1c  Bta-Mir-30-P1c  Cfa-Mir-30-P1c  Cli-Mir-30-P1c  Cpi-Mir-30-P1c  Cpo-Mir-30-P1c  Dno-Mir-30-P1c  Dre-Mir-30-P1c  Ete-Mir-30-P1c  Hsa-Mir-30-P1c  Mdo-Mir-30-P1c  Mml-Mir-30-P1c  Mmu-Mir-30-P1c  Oan-Mir-30-P1c  Ocu-Mir-30-P1c  Rno-Mir-30-P1c  Sha-Mir-30-P1c  Sto-Mir-30-P1c  Tgu-Mir-30-P1c  Xtr-Mir-30-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
2: 142761260-142761318 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-30-P1c)
Mir-30-P2c 2: 142757727-142757786 [-] UCSC Ensembl
Mir-30-P1c 2: 142761260-142761318 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCUGCAGUGAUGUAUAGUAGUCUGUUGCUGUAAACAUCCCCGACUGGAAGCUGUAGCAGCUUGAGCUUUCAGUCAGAUGUUUGCUGCACCUGGCUAUACCUGGACAGCAUCAGGAGG
Get precursor sequence
Structure
        10          20        30        40        50          
CACCUGCAGUGAUGUAUA--|     UGU   U         CCC           GUAGC 
                    GUAGUC   UGC GUAAACAUC   GACUGGAAGCU     \
                    UAUCGG   ACG CGUUUGUAG   CUGACUUUCGA     A
GGAGGACUACGACAGGUCCA^     UCC   U         A--           GUUCG 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-30-P1c_5p

MirBase accessionMIMAT0001129
Sequence
0- UGUAAACAUCCCCGACUGGAAGCU -24
Get sequence
Validated targets TargetScanVert: gga-miR-30d
miRDB: MIMAT0001129
Star sequence

Gga-Mir-30-P1c_3p*

MirBase accessionNone
Sequence
37- CUUUCAGUCAGAUGUUUGCUGC -59
Get sequence