MirGeneDB

Gene name

Gga-Mir-29-P1b

Family name MIR-29 (all species)
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-29c
Paralogues Gga-Mir-29-P1a  Gga-Mir-29-P2a  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P1b  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
26: 2698824-2698883 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b-v1 26: 2699729-2699791 [-] UCSC Ensembl
Mir-29-P2b-v2 26: 2699730-2699790 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCCAGAAAAAUGUCUCUUACACAGGCUGACCGAUUUCUCUUGGUGUUCAGAGUCUCAGUUUCUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGAAAAGCAACAAUAAUGGA
Get precursor sequence
Structure
        10            20         30        40        50          
GAGCCAGAAAAAUGUCU----      -| GGC           UCU       C   GUCUCA 
                     CUUACA CA   UGACCGAUUUC   UGGUGUU AGA      \
                     GGAUGU GU   AUUGGCUAAAG   ACCACGA UCU      G
AGGUAAUAACAACGAAAAGGG      A^ ---           UUU       -   GUCUUU 
.       110       100           90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-29-P1b_5p*

MirBase accessionMIMAT0026544
Sequence
0- ACCGAUUUCUCUUGGUGUUCAGA -23
Get sequence
Validated targets TargetScanVert: gga-miR-29c-5p
miRDB: MIMAT0026544
Mature sequence

Gga-Mir-29-P1b_3p

MirBase accessionMIMAT0001183
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence
Seed sequenceAGCACCA
Validated targets TargetScanVert: gga-miR-29c-3p
miRDB: MIMAT0001183