MirGeneDB

Gene name

Gga-Mir-214

Family name MIR-214 (all species)
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-214
Paralogues
Orthologues Aca-Mir-214  Ami-Mir-214  Bta-Mir-214  Cfa-Mir-214  Cli-Mir-214  Cpi-Mir-214  Cpo-Mir-214  Dno-Mir-214  Dre-Mir-214  Ete-Mir-214  Hsa-Mir-214  Mdo-Mir-214-v1  Mdo-Mir-214-v2  Mml-Mir-214  Mmu-Mir-214  Oan-Mir-214-v1  Oan-Mir-214-v2  Ocu-Mir-214  Rno-Mir-214  Sha-Mir-214-v1  Sha-Mir-214-v2  Sto-Mir-214  Tgu-Mir-214  Xtr-Mir-214 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(galGal5)
8: 4658342-4658404 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-214)
Mir-199-P3-v1 8: 4652492-4652552 [+] UCSC Ensembl
Mir-199-P3-v2 8: 4652492-4652552 [+] UCSC Ensembl
Mir-199-P3-v3 8: 4652492-4652552 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGACUGGCUGGACGGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCUCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAGUGACAGCCG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGACUGGCUGGACGGA--|          U          ACA          AGAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGC        \
                   CAACAGUACAC GACGGACAGA   GGACGACAUG        C
GCCGACAGUGAGUCCGACC^          U          CAC          UCCACUCU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-214_5p*

MirBase accessionNone
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Mature sequence

Gga-Mir-214_3p

MirBase accessionMIMAT0007751
Sequence
41- ACAGCAGGCACAGACAGGCAGU -63
Get sequence
Seed sequenceCAGCAGG
Validated targets TargetScanVert: gga-miR-214
miRDB: MIMAT0007751