MirGeneDB

Gene name

Gga-Mir-190-P2

Family name MIR-190 (all species)
MiRBase ID gga-mir-190b
Paralogues Gga-Mir-190-P1 
Orthologues Aae-Mir-190  Aca-Mir-190-P2  Ami-Mir-190-P2  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P2  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P2  Cgi-Mir-190  Cpi-Mir-190-P2  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P2  Ete-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P2  Isc-Mir-190  Mdo-Mir-190-P2  Mml-Mir-190-P2  Mmu-Mir-190-P2  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P2  Sha-Mir-190-P2  Sko-Mir-190  Tca-Mir-190  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
25: 2120335-2120393 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCCCGGGCCCGUCCCGCCCUGCCUCUGUCUGAUAUGUUUGAUAUUAGGUUGUUUGAUUGGAAACCAACUAAAUAUCAAACAUAUUCUUACAGCGGCAGGGCCUCCCAGCGCCGCGUGC
Get precursor sequence
Structure
        10         20        30         40        50         
GCCCCGGGCCCGUCCCG-       U    CU -|             A     UUUGAU 
                  CCCUGCC CUGU  G AUAUGUUUGAUAUU GGUUG      \
                  GGGACGG GACA  C UAUACAAACUAUAA UCAAC      U
CGUGCGCCGCGACCCUCC       C    UU U^             A     CAAAGG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-190-P2_5p

MirBase accessionMIMAT0037546
Sequence
0- UGAUAUGUUUGAUAUUAGGUUG -22
Get sequence
Seed sequenceGAUAUGU
Star sequence

Gga-Mir-190-P2_3p*

MirBase accessionMIMAT0037547
Sequence
37- ACUAAAUAUCAAACAUAUUCUU -59
Get sequence