MirGeneDB

Gene name

Gga-Mir-181-P1a

Family name MIR-181 (all species)
MiRBase ID gga-mir-181a-1
Paralogues Gga-Mir-181-P1b  Gga-Mir-181-P2a  Gga-Mir-181-P2b 
Orthologues Aca-Mir-181-P1a  Ami-Mir-181-P1a  Bta-Mir-181-P1a  Cfa-Mir-181-P1a  Cli-Mir-181-P1a  Cpi-Mir-181-P1a  Cpo-Mir-181-P1a  Dno-Mir-181-P1a  Dre-Mir-181-P1a1  Dre-Mir-181-P1a2  Ete-Mir-181-P1a  Hsa-Mir-181-P1a  Mdo-Mir-181-P1a  Mml-Mir-181-P1a  Mmu-Mir-181-P1a  Ocu-Mir-181-P1a  Rno-Mir-181-P1a  Sha-Mir-181-P1a  Tgu-Mir-181-P1a  Xtr-Mir-181-P1a 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
8: 2005188-2005249 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1a)
Mir-181-P2a 8: 2005372-2005431 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGAGUUCUCUUGUAGUGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUUAAGUGAAAACCAUCGACCGUUGAUUGUACCCUCCAGCUAACCAUCCUCCUCCUUACUUCA
Get precursor sequence
Structure
        10         20         30        40        50        60  
UGGAGUUCUCUUGUAGU-    -|  UC  UGA   U      CU       A  UUGGAAUU 
                  GGUU GCU  AG   ACA UCAACG  GUCGGUG GU        \
                  CCAA CGA  UC   UGU AGUUGC  CAGCUAC CA        U
ACUUCAUUCCUCCUCCUA    U^  CC  CCA   U      --       -  AAAGUGAA 
120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-181-P1a_5p

MirBase accessionMIMAT0001168
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Seed sequenceACAUUCA
Validated targets TargetScanVert: gga-miR-181a-5p
miRDB: MIMAT0001168
Star sequence

Gga-Mir-181-P1a_3p*

MirBase accessionMIMAT0001150
Sequence
40- ACCAUCGACCGUUGAUUGUACC -62
Get sequence
Validated targets TargetScanVert: gga-miR-181a-3p
miRDB: MIMAT0001150