
Gene name


Family name MIR-146 (all species)
MiRBase ID gga-mir-146b
Paralogues Gga-Mir-146-P1  Gga-Mir-146-P3 
Orthologues Aca-Mir-146-P2  Ami-Mir-146-P2  Bta-Mir-146-P2  Cfa-Mir-146-P2  Cli-Mir-146-P2  Cpi-Mir-146-P2  Cpo-Mir-146-P2  Dno-Mir-146-P2  Dre-Mir-146-P2  Ete-Mir-146-P2  Hsa-Mir-146-P2  Mdo-Mir-146-P2  Mml-Mir-146-P2  Mmu-Mir-146-P2  Ocu-Mir-146-P2  Rno-Mir-146-P2  Sha-Mir-146-P2  Tgu-Mir-146-P2 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
6: 23143404-23143464 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50         60
GGAAGCCAGCGAGGACUG--|     UG   UUG          U       -    AAAGC 
                    GCUGCU  GCU   AGAACUGAAU CCAUAGG CGUU     A
                    CGACGG  UGA   UCUUGACUUA GGUAUCC GUAA     U
ACUUCCGACCUCCAAAUAAA^     GU   CG-          -       C    AAACC 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence


MirBase accessionMIMAT0003351
Get sequence
Seed sequenceGAGAACU
Validated targets TargetScanVert: gga-miR-146b-5p
miRDB: MIMAT0003351
Star sequence


MirBase accessionMIMAT0003724
Get sequence
Validated targets TargetScanVert: gga-miR-146b-3p
miRDB: MIMAT0003724