MirGeneDB

Gene name

Gga-Mir-142-P1-v3

Family name MIR-142 (all species)
MiRBase ID gga-mir-142
Paralogues Gga-Mir-142-P1-v1  Gga-Mir-142-P1-v2 
Orthologues Ami-Mir-142-P1-v1  Ami-Mir-142-P1-v2  Ami-Mir-142-P1-v3  Ami-Mir-142-P1-v4  Bta-Mir-142-P1-v1  Bta-Mir-142-P1-v2  Bta-Mir-142-P1-v3  Bta-Mir-142-P1-v4  Cfa-Mir-142-P1-v1  Cfa-Mir-142-P1-v2  Cfa-Mir-142-P1-v3  Cfa-Mir-142-P1-v4  Cli-Mir-142-P1-v1  Cli-Mir-142-P1-v2  Cli-Mir-142-P1-v3  Cli-Mir-142-P1-v4  Cpi-Mir-142-P1-v1  Cpi-Mir-142-P1-v2  Cpi-Mir-142-P1-v3  Cpi-Mir-142-P1-v4  Cpo-Mir-142-P1-v1  Cpo-Mir-142-P1-v2  Cpo-Mir-142-P1-v3  Cpo-Mir-142-P1-v4  Dno-Mir-142-P1-v1  Dno-Mir-142-P1-v2  Dno-Mir-142-P1-v3  Dre-Mir-142-P1-v1  Dre-Mir-142-P1-v2  Dre-Mir-142-P1-v3  Dre-Mir-142-P1-v4  Ete-Mir-142-P1-v1  Ete-Mir-142-P1-v2  Ete-Mir-142-P1-v3  Ete-Mir-142-P1-v4  Hsa-Mir-142-P1-v1  Hsa-Mir-142-P1-v2  Hsa-Mir-142-P1-v3  Mdo-Mir-142-P1-v1  Mdo-Mir-142-P1-v2  Mdo-Mir-142-P1-v3  Mdo-Mir-142-P1-v4  Mml-Mir-142-P1-v1  Mml-Mir-142-P1-v2  Mml-Mir-142-P1-v3  Mml-Mir-142-P1-v4  Mmu-Mir-142-P1-v1  Mmu-Mir-142-P1-v2  Mmu-Mir-142-P1-v3  Mmu-Mir-142-P1-v4  Ocu-Mir-142-P1-v1  Ocu-Mir-142-P1-v2  Ocu-Mir-142-P1-v3  Ocu-Mir-142-P1-v4  Rno-Mir-142-P1-v1  Rno-Mir-142-P1-v2  Rno-Mir-142-P1-v3  Rno-Mir-142-P1-v4  Sha-Mir-142-P1-v1  Sha-Mir-142-P1-v2  Sha-Mir-142-P1-v3  Sha-Mir-142-P1-v4  Tgu-Mir-142-P1-v1  Tgu-Mir-142-P1-v2  Tgu-Mir-142-P1-v3  Tgu-Mir-142-P1-v4  Xtr-Mir-142-P1a-v1  Xtr-Mir-142-P1a-v2  Xtr-Mir-142-P1a-v3  Xtr-Mir-142-P1a-v4  Xtr-Mir-142-P1b-v1  Xtr-Mir-142-P1b-v2  Xtr-Mir-142-P1b-v3  Xtr-Mir-142-P1b-v4 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
19: 510426-510485 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-P1-v3)
Mir-142-P1-v1 19: 510426-510485 [-] UCSC Ensembl
Mir-142-P1-v2 19: 510426-510485 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGACACCGACUGAGAGACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAAACAGCACUGCAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGGGCUACGGAGAAGAGAA
Get precursor sequence
Structure
        10          20        30        40        50         
CGACACCGACUGAGAGA--|      G   C           A         UAAACAGC 
                   CAGUGCA UCA CCAUAAAGUAG AAGCACUAC        A
                   GUCAUGU AGU GGUAUUUCAUC UUUGUGAUG        C
AAGAGAAGAGGCAUCGGGU^      G   A           C         UGGGACGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-142-P1-v3_5p*

MirBase accessionMIMAT0001193
Sequence
0- CAUAAAGUAGAAAGCACUACUAA -23
Get sequence
Validated targets TargetScanVert: gga-miR-142-5p
miRDB: MIMAT0001193
Mature sequence

Gga-Mir-142-P1-v3_3p

MirBase accessionMIMAT0001194
Sequence
37- UGUAGUGUUUCCUACUUUAUGGA -60
Get sequence
Seed sequenceGUAGUGU
Validated targets TargetScanVert: gga-miR-142-3p
miRDB: MIMAT0001194