MirGeneDB

Gene name

Gga-Mir-140-v1

Family name MIR-140 (all species)
MiRBase ID gga-mir-140
Paralogues Gga-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Ami-Mir-140-v1  Bta-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dno-Mir-140-v1  Dre-Mir-140-v1  Ete-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Ocu-Mir-140-v1  Rno-Mir-140-v1  Sha-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
11: 19310321-19310382 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v1)
Mir-140-v2 11: 19310321-19310382 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCUGCUGCCUGCGUCUCUCCGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACGGGAUGCCGGGGCUGCCUCUGCGUCCGAGG
Get precursor sequence
Structure
        10         20          30        40        50        60
UCCUGCUGCCUGCGUCU-    -        -| A             A      GUUACGU 
                  CUCC GUGUCCUG CC GUGGUUUUACCCU UGGUAG       C
                  GGGG CGUAGGGC GG CACCAAGAUGGGA ACCAUC       A
GGAGCCUGCGUCUCCGUC    C        A^ -             C      UUGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-140-v1_5p*

MirBase accessionMIMAT0001159
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Validated targets TargetScanVert: gga-miR-140-5p
miRDB: MIMAT0001159
Mature sequence

Gga-Mir-140-v1_3p

MirBase accessionMIMAT0003722
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence
Seed sequenceCCACAGG
Validated targets TargetScanVert: gga-miR-140-3p
miRDB: MIMAT0003722