MirGeneDB

Gene name

Gga-Mir-1397

Family name MIR-1397 (all species)
MiRBase ID gga-mir-1397
Paralogues
Orthologues Aca-Mir-1397  Ami-Mir-1397  Cpi-Mir-1397  Sha-Mir-1397  Tgu-Mir-1397 
Node of Origin (gene) Amniota
Node of Origin (family) Amniota
Genome context
(galGal5)
1: 126961716-126961773 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAGCUGUUGACUGAAUGCGAUGUGUGCAUUGCAUUGCGACGGGUUAUAUCACUAAUCGUAACAUGAUGUAACCCAACGCAGCAUGAUGUAAGCGUCGUGAAACGUUGGAGAUUUAGA
Get precursor sequence
Structure
        10          20        30        40        50        
AAAGCUGUUGACUGAAU--|      G       CA     AC           CUAAU 
                   GCGAUGU UGCAUUG  UUGCG  GGGUUAUAUCA     C
                   UGCUGCG AUGUAGU  GACGC  CCCAAUGUAGU     G
AGAUUUAGAGGUUGCAAAG^      A       AC     AA           ACAAU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-1397_5p

MirBase accessionMIMAT0007283
Sequence
0- UGCAUUGCGACGGGUUAUAUCA -22
Get sequence
Seed sequenceGCAUUGC
Validated targets TargetScanVert: gga-miR-1397-5p
miRDB: MIMAT0007283
Star sequence

Gga-Mir-1397_3p*

MirBase accessionMIMAT0007284
Sequence
36- AUGUAACCCAACGCAGCAUGAU -58
Get sequence
Validated targets TargetScanVert: gga-miR-1397-3p
miRDB: MIMAT0007284