MirGeneDB

Gene name

Gga-Mir-126-v1

Family name MIR-126 (all species)
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-126
Paralogues Gga-Mir-126-v2  Gga-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(galGal5)
17: 8233325-8233383 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 17: 8233325-8233383 [-] UCSC Ensembl
Mir-126-v3 17: 8233325-8233383 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGGAGCAUCAGGAGCUGCUGGUGACGGCCCAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUGGUCAGCACUGGCAUCACGUGGGCAA
Get precursor sequence
Structure
        10          20        30        40        50         
AAGGAGCAUCAGGAGCU--|    UG     C           U       CGCUGUGAC 
                   GCUGG  ACGGC CAUUAUUACUU UGGUACG         \
                   CGACU  UGUCG GUAAUAAUGAG GCCAUGC         A
AACGGGUGCACUACGGUCA^    GG     C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-126-v1_5p

MirBase accessionMIMAT0003723
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Validated targets TargetScanVert: gga-miR-126-5p
miRDB: MIMAT0003723
Star sequence

Gga-Mir-126-v1_3p*

MirBase accessionMIMAT0001169
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Validated targets TargetScanVert: gga-miR-126-3p
miRDB: MIMAT0001169