MirGeneDB

Gene name

Gga-Let-7-P14

Family name LET-7 (all species)
MiRBase ID gga-let-7k
Paralogues Gga-Let-7-P1  Gga-Let-7-P3  Gga-Let-7-P4  Gga-Let-7-P5  Gga-Let-7-P6  Gga-Let-7-P7  Gga-Let-7-P8  Gga-Let-7-P11  Gga-Let-7-P12  Gga-Let-7-P13 
Orthologues Aae-Let-7  Aca-Let-7-P14  Ami-Let-7-P14  Bge-Let-7  Cgi-Let-7  Cli-Let-7-P14  Cpi-Let-7-P14  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P14a  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P14 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
26: 1640137-1640207 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P14)
Let-7-P13 26: 1639932-1640009 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUGGCAAUGGUCCCAAGCUGUCCUUGAGGCUGAGGUAGUAGAUUGAAUAGUUGUGGAGUCCUAUCCUCCCUUUGAGCUAACUAUACAAUCUACUGUCUUUCCUAAGGAGACAGUCAGAUCUUCAGUUCGUC
Get precursor sequence
Structure
        10         20         30        40        50        60     
AUGGCAAUGGUCCCAAG-     -|  G   CU   GU         A      GUGGAGUCCUAU 
                  CUGUC CUU AGG  GAG  AGUAGAUUG AUAGUU            C
                  GACAG GGA UCC  UUC  UCAUCUAAC UAUCAA            C
CUGCUUGACUUCUAGACU     A^  A   U-   UG         A      UCGAGUUUCCCU 
 .       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Let-7-P14_5p

MirBase accessionMIMAT0001182
Sequence
0- UGAGGUAGUAGAUUGAAUAGUU -22
Get sequence
Seed sequenceGAGGUAG
Validated targets TargetScanVert: gga-let-7k-5p
miRDB: MIMAT0001182
Star sequence

Gga-Let-7-P14_3p*

MirBase accessionMIMAT0026543
Sequence
50- CUAUACAAUCUACUGUCUUUC -71
Get sequence
Validated targets TargetScanVert: gga-let-7k-3p
miRDB: MIMAT0026543