MirGeneDB

Gene name

Ete-Mir-126-v1

Family name MIR-126 (all species)
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-126-v2  Ete-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(echTel2)
JH980382: 1748752-1748810 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GACCUGCGGCCGCCCGUGCCGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACGUCAAACUCGUACCGUGAGUAAUAAUGCGCUGUCGGUGGCCCCGCGCCACGCCGUGGAC
Get precursor sequence
Structure
        10          20        30        40        50         
GACCUGCGGCCGCCCGU--|   G      GA           U       CGCUGUGAC 
                   GCCG CGACGG  CAUUAUUACUU UGGUACG         \
                   CGGU GCUGUC  GUAAUAAUGAG GCCAUGC         A
CAGGUGCCGCACCGCGCCC^   G      GC           U       UCAAACUGC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ete-Mir-126-v1_5p

MirBase accessionNone
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Star sequence

Ete-Mir-126-v1_3p*

MirBase accessionNone
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence