MirGeneDB

MirGeneDB ID

Efe-Mir-193-P1g

Family name MIR-193 (all species)
Seed ACUGGCC
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-193-P1h  Efe-Mir-193-P2c-v1  Efe-Mir-193-P2c-v2  Efe-Mir-193-P2d-v1  Efe-Mir-193-P2d-v2  Efe-Mir-193-P2e-v1  Efe-Mir-193-P2e-v2  Efe-Mir-193-P2f-v1  Efe-Mir-193-P2f-v2 
Orthologues Aae-Mir-193-P1  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cgi-Mir-193-P1  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dpu-Mir-193-P1  Hme-Mir-193-P1  Isc-Mir-193-P1  Lgi-Mir-193-P1  Pmi-Mir-193-P1  Tca-Mir-193-P1 
Node of Origin (locus) E. fetida
Node of Origin (family) Bilateria
Genome context
(Efe_combined)
Efet.01.601053: 958-1017 [-]
Precursor
(pre-Mir +30nt flank)
AGCCUAUAAACACCUAAGGUGACUUCCGACGCGGGCUUAUAGGUCCAGAAGAUGAAUGCGAUAGUCUCUACUGGCCUUUAUAGUCCCACUCGGAUACCCUUAAAAACGACGGAAUAGUAA
Get precursor sequence
Structure
        10             20        30        40         50         
AGCCUAUAAACACCUAA-----|   ACU     CGC     UAU-   U    A   UGAAUG 
                      GGUG   UCCGA   GGGCU    AGG CCAG AGA      C
                      CCAU   AGGCU   CCUGA    UCC GGUC UCU      G
AAUGAUAAGGCAGCAAAAAUUC^   ---     CAC     UAUU   -    A   CUGAUA 
.       110       100           90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Efe-Mir-193-P1g_5p*

MirBase accessionNone
Sequence
0- GCGGGCUUAUAGGUCCAGAAGA -22
Get sequence
Mature sequence

Efe-Mir-193-P1g_3p

MirBase accessionNone
Sequence
38- UACUGGCCUUUAUAGUCCCACU -60
Get sequence