MirGeneDB

Gene name

Dre-Mir-92-P3a

Family name MIR-92 (all species)
MiRBase ID dre-mir-92b
Paralogues Dre-Mir-92-P1a1  Dre-Mir-92-P1a2  Dre-Mir-92-P2  Dre-Mir-92-P4a 
Orthologues Ami-Mir-92-P3  Asu-Mir-92  Bfl-Mir-92-o3  Bta-Mir-92-P3  Cel-Mir-92  Cfa-Mir-92-P3  Cpi-Mir-92-P3  Cpo-Mir-92-P3  Dno-Mir-92-P3  Ete-Mir-92-P3  Hsa-Mir-92-P3  Isc-Mir-92  Mdo-Mir-92-P3  Mml-Mir-92-P3  Mmu-Mir-92-P3  Ocu-Mir-92-P3  Rno-Mir-92-P3  Sha-Mir-92-P3  Tgu-Mir-92-P3  Xtr-Mir-92-P3 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(danRer11_plustraces)
chr16: 42898443-42898505 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUUUGUGUUUGUAAUCCUACGGGCAGGGAGGUGUGGGAUGUUGUGCAGUGUUGUUCAAUCUCCCGCCAAUAUUGCACUCGUCCCGGCCUCCCUGACCACGAGGAACACGCGACUCCCUGCU
Get precursor sequence
Structure
        10         20          30        40        50        60  
UCAUUUGUGUUUGUAAU-   A  -  -|        G       UU          GUUCAAU 
                  CCU CG GG CAGGGAGGU UGGGAUG  GUGCAGUGUU       \
                  GGA GC CC GUCCCUCCG GCCCUGC  CACGUUAUAA       C
UCGUCCCUCAGCGCACAA   -  A  A^        -       U-          CCGCCCU 
 120       110        100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-92-P3a_5p*

MirBase accessionMIMAT0031955
Sequence
0- AGGUGUGGGAUGUUGUGCAGUGUU -24
Get sequence
Mature sequence

Dre-Mir-92-P3a_3p

MirBase accessionMIMAT0001809
Sequence
41- UAUUGCACUCGUCCCGGCCUCC -63
Get sequence
Seed sequenceAUUGCAC
Validated targets TargetScanFish: dre-miR-92b