MirGeneDB

MirGeneDB ID

Dre-Mir-92-P1a2

Family name MIR-92 (all species)
Seed AUUGCAC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-92a-2
Paralogues Dre-Mir-92-P1a1  Dre-Mir-92-P1c1  Dre-Mir-92-P2b1  Dre-Mir-92-P2c 
Orthologues Aca-Mir-92-P1a  Ami-Mir-92-P1a  Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1a  Cel-Mir-92  Cfa-Mir-92-P1a  Cli-Mir-92-P1a  Cpi-Mir-92-P1a  Cpo-Mir-92-P1a  Dno-Mir-92-P1a  Ete-Mir-92-P1a  Gga-Mir-92-P1a  Hsa-Mir-92-P1a  Isc-Mir-92  Mdo-Mir-92-P1a  Mml-Mir-92-P1a  Mmu-Mir-92-P1a  Oan-Mir-92-P1a2  Ocu-Mir-92-P1a  Rno-Mir-92-P1a  Sha-Mir-92-P1a  Sto-Mir-92-P1a  Tgu-Mir-92-P1a  Xtr-Mir-92-P1a 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr9: 53436299-53436355 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1a2)
Mir-92-P1a2 chr9: 53436299-53436355 [-] UCSC Ensembl
Mir-17-P2a2 chr9: 53436841-53436905 [-] UCSC Ensembl
Mir-17-P1a2 chr9: 53436955-53437013 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGUCAGAUCACAGCAUCCCUUUCUUUGCAGGUUGGGAUCGGCCGCAAUGCUCUGUGCUGGAAGUAUUGCACUUGUCCCGGCCUGUGAAGAGCAUGGGAAAUUGUUCGGCUGCUUU
Get precursor sequence
Structure
        10        20          30        40        50        
CCCGUCAGAUCACAGCAU   U--|    UG           C  CC        CUGU 
                  CCC   UUCUU  CAGGUUGGGAU GG  GCAAUGCU    G
                  GGG   GAGAA  GUCCGGCCCUG UC  CGUUAUGA    C
UUUCGUCGGCUUGUUAAA   UAC^    GU           U  A-        AGGU 
     110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-92-P1a2_5p*

MirBase accessionMIMAT0031954
Sequence
0- AGGUUGGGAUCGGCCGCAAUGCU -23
Get sequence
Mature sequence

Dre-Mir-92-P1a2_3p

MirBase accessionMIMAT0001808
Sequence
35- UAUUGCACUUGUCCCGGCCUGU -57
Get sequence
Validated targets TargetScanFish: dre-miR-92a