MirGeneDB

Gene name

Dre-Mir-723

Family name MIR-723 (all species)
MiRBase ID dre-mir-723
Paralogues
Orthologues
Node of Origin (gene) Neopterygii
Node of Origin (family) Neopterygii
Genome context
(danRer11_plustraces)
chrUn_KN149706v1: 28040-28100 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCCAGAAGAAUCACUGCGUAGAGAUAAAGACAGUUUUAAAUGAUGUUACUUUUUUUCAAAUGGAGAAAGACAUCAAUUAAAUCUGUGCUUAUCUCUACAAGCAAGCCAUUGAGAGCCGG
Get precursor sequence
Structure
        10          20        30        40        50          
CCCCCAGAAGAAUCACUGC--|         AG    U     A       ACUUUUUUUC 
                     GUAGAGAUAA  ACAG UUUAA UGAUGUU          \
                     CAUCUCUAUU  UGUC AAAUU ACUACAG          A
GGCCGAGAGUUACCGAACGAA^         CG    U     A       AAAGAGGUAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-723_5p*

MirBase accessionMIMAT0003750
Sequence
0- GACAGUUUUAAAUGAUGUUACU -22
Get sequence
Mature sequence

Dre-Mir-723_3p

MirBase accessionMIMAT0003751
Sequence
39- AGACAUCAAUUAAAUCUGUGCU -61
Get sequence
Seed sequenceGACAUCA
Validated targets TargetScanFish: dre-miR-723