MirGeneDB

Gene name

Dre-Mir-489

Family name MIR-489 (all species)
MiRBase ID dre-mir-489
Paralogues
Orthologues Aca-Mir-489  Ami-Mir-489  Bta-Mir-489  Cfa-Mir-489  Cli-Mir-489  Cpi-Mir-489  Dno-Mir-489  Gga-Mir-489  Hsa-Mir-489  Mml-Mir-489  Mmu-Mir-489  Ocu-Mir-489  Rno-Mir-489  Tgu-Mir-489  Xtr-Mir-489-v1  Xtr-Mir-489-v2 
Node of Origin (gene) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(danRer11_plustraces)
chr19: 40781189-40781249 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAAUGGACUGACUUGAGUGGUGGCCUGGUGGUCGUAUGUAUGACGUCAUUUACUUCAAAGUUUGGAGUGACAUCAUAUGUACGGCUGCUAAACUGCUACAUGGCUCAUCAGAAAGCUCA
Get precursor sequence
Structure
        10          20        30        40        50          
ACAAAUGGACUGACUUGA--|   UG CC   UG             C      UACUUCA 
                    GUGG  G  UGG  GUCGUAUGUAUGA GUCAUU       \
                    CAUC  C  AUC  CGGCAUGUAUACU CAGUGA       A
ACUCGAAAGACUACUCGGUA^   GU AA   GU             A      GGUUUGA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-489_5p*

MirBase accessionNone
Sequence
0- UGGUCGUAUGUAUGACGUCAUU -22
Get sequence
Mature sequence

Dre-Mir-489_3p

MirBase accessionMIMAT0002940
Sequence
39- UGACAUCAUAUGUACGGCUGCU -61
Get sequence
Seed sequenceGACAUCA
Validated targets TargetScanFish: dre-miR-489