MirGeneDB

Gene name

Dre-Mir-455-P1-v2

Family name MIR-455 (all species)
MiRBase ID dre-mir-455-1
Paralogues Dre-Mir-455-P1-v1  Dre-Mir-455-P2-v1  Dre-Mir-455-P2-v2 
Orthologues
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr5: 65250400-65250460 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-455-P1-v2)
Mir-455-P1-v1 chr5: 65250401-65250459 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGAAUGCCCGUGUGAUCCCUGGUGUGAGGGUAUGUGCCCUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAGAUCUUCACCGAGCGA
Get precursor sequence
Structure
        10           20        30        40        50         
CCGAAUGCCCGUGUGAU---| C   U UG  G          U      A   CGUGGAA 
                    CC UGG G  AG GUAUGUGCCC UGGACU CAU       G
                    GG ACU C  UC CAUAUACGGG ACCUGA GUA       C
AGCGAGCCACUUCUAGAUCC^ A   C GU  A          U      C   CCACGAC 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-455-P1-v2_5p* (predicted)

MirBase accessionMIMAT0001879
Sequence
0- GUAUGUGCCCUUGGACUACAU -21
Get sequence
Validated targets TargetScanFish: dre-miR-455
Mature sequence

Dre-Mir-455-P1-v2_3p

MirBase accessionMIMAT0031993
Sequence
39- GCAGUCCAUGGGCAUAUACACU -61
Get sequence
Seed sequenceCAGUCCA