MirGeneDB

Gene name

Dre-Mir-455-P1-v1

Family name MIR-455 (all species)
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-455-1
Paralogues Dre-Mir-455-P1-v2  Dre-Mir-455-P2-v1  Dre-Mir-455-P2-v2 
Orthologues Oan-Mir-455 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces2)
chr5: 65250401-65250459 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-455-P1-v1)
Mir-455-P1-v2 chr5: 65250400-65250460 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGAAUGCCCGUGUGAUCCCUGGUGUGAGGGUAUGUGCCCUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAGAUCUUCACCGAGCG
Get precursor sequence
Structure
        10           20        30        40        50        
CGAAUGCCCGUGUGAUC--  -|  U UG  G          U      A   C UGGAA 
                   CC UGG G  AG GUAUGUGCCC UGGACU CAU G     G
                   GG ACU C  UC CAUAUACGGG ACCUGA GUA C     C
GCGAGCCACUUCUAGAUCC  A^  C GU  A          U      C   C ACGAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-455-P1-v1_5p

MirBase accessionMIMAT0001879
Sequence
0- UAUGUGCCCUUGGACUACAUCG -22
Get sequence
Seed sequenceAUGUGCC
Validated targets TargetScanFish: dre-miR-455
Star sequence

Dre-Mir-455-P1-v1_3p*

MirBase accessionMIMAT0031993
Sequence
36- AUGCAGUCCAUGGGCAUAUACAC -59
Get sequence