
Gene name


Family name MIR-430 (all species)
MiRBase ID dre-mir-430b-4
Paralogues Dre-Mir-430-o1a  Dre-Mir-430-o1b1  Dre-Mir-430-o1b2  Dre-Mir-430-o1b3  Dre-Mir-430-o1b4  Dre-Mir-430-o1b5  Dre-Mir-430-o1b6  Dre-Mir-430-o1b7  Dre-Mir-430-o1b8  Dre-Mir-430-o1c  Dre-Mir-430-o1d1  Dre-Mir-430-o1d2  Dre-Mir-430-o1d3  Dre-Mir-430-o1d4  Dre-Mir-430-o1d5  Dre-Mir-430-o1d6  Dre-Mir-430-o1d7  Dre-Mir-430-o1e1  Dre-Mir-430-o1e2  Dre-Mir-430-o1e3  Dre-Mir-430-o2a1  Dre-Mir-430-o2a2  Dre-Mir-430-o2a3  Dre-Mir-430-o2a4  Dre-Mir-430-o2a5  Dre-Mir-430-o2a6  Dre-Mir-430-o2a7  Dre-Mir-430-o2a8  Dre-Mir-430-o2a9  Dre-Mir-430-o2a10  Dre-Mir-430-o2a11  Dre-Mir-430-o2a12  Dre-Mir-430-o2a13  Dre-Mir-430-o2a14  Dre-Mir-430-o2c1  Dre-Mir-430-o2c2  Dre-Mir-430-o2c3  Dre-Mir-430-o2d1  Dre-Mir-430-o2d2  Dre-Mir-430-o3a1  Dre-Mir-430-o3a2  Dre-Mir-430-o3a3  Dre-Mir-430-o3a4  Dre-Mir-430-o3a5  Dre-Mir-430-o3a6  Dre-Mir-430-o3a7  Dre-Mir-430-o3a8  Dre-Mir-430-o3a9  Dre-Mir-430-o3a10  Dre-Mir-430-o3a11  Dre-Mir-430-o3a12  Dre-Mir-430-o3a13  Dre-Mir-430-o3a14  Dre-Mir-430-o3a15  Dre-Mir-430-o3a16  Dre-Mir-430-o3b1  Dre-Mir-430-o3b2 
Orthologues Aca-Mir-430-P2  Ami-Mir-430-P2  Bta-Mir-430-P2  Cfa-Mir-430-P2  Cli-Mir-430-P2  Cpi-Mir-430-P2  Cpo-Mir-430-P2  Dno-Mir-430-P2  Ete-Mir-430-P2  Gga-Mir-430-P2  Hsa-Mir-430-P2  Mdo-Mir-430-P2  Mml-Mir-430-P2  Mmu-Mir-430-P2  Ocu-Mir-430-P2  Rno-Mir-430-P2  Sha-Mir-430-P2  Tgu-Mir-430-P2  Xtr-Mir-430-P2 
Node of Origin (gene) D. rerio
Node of Origin (family) Vertebrata
Genome context
chr4: 28693640-28693698 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-o2b)
Mir-430-o3a1 chr4: 28693379-28693437 [+] UCSC Ensembl
Mir-430-o1d1 chr4: 28693846-28693904 [+] UCSC Ensembl
Mir-430-o3a2 chr4: 28693983-28694041 [+] UCSC Ensembl
Mir-430-o2a1 chr4: 28694231-28694289 [+] UCSC Ensembl
Mir-430-o1b1 chr4: 28694962-28695020 [+] UCSC Ensembl
Mir-430-o3a3 chr4: 28695121-28695179 [+] UCSC Ensembl
Mir-430-o2a2 chr4: 28695382-28695440 [+] UCSC Ensembl
Mir-430-o1d2 chr4: 28695588-28695646 [+] UCSC Ensembl
Mir-430-o3a4 chr4: 28695725-28695783 [+] UCSC Ensembl
Mir-430-o2a3 chr4: 28695972-28696030 [+] UCSC Ensembl
Mir-430-o1b2 chr4: 28696703-28696761 [+] UCSC Ensembl
Mir-430-o3a5 chr4: 28696862-28696920 [+] UCSC Ensembl
Mir-430-o2c1 chr4: 28697123-28697181 [+] UCSC Ensembl
Mir-430-o1d3 chr4: 28697329-28697387 [+] UCSC Ensembl
Mir-430-o3a6 chr4: 28697466-28697524 [+] UCSC Ensembl
Mir-430-o2a4 chr4: 28697727-28697785 [+] UCSC Ensembl
Mir-430-o1d4 chr4: 28697933-28697991 [+] UCSC Ensembl
Mir-430-o2d1 chr4: 28698317-28698375 [+] UCSC Ensembl
Mir-430-o1b3 chr4: 28699047-28699105 [+] UCSC Ensembl
Mir-430-o3a7 chr4: 28699206-28699264 [+] UCSC Ensembl
Mir-430-o2a5 chr4: 28699467-28699525 [+] UCSC Ensembl
Mir-430-o1e1 chr4: 28699673-28699732 [+] UCSC Ensembl
Mir-430-o3a16 chr4: 28699832-28699890 [+] UCSC Ensembl
Mir-430-o2a6 chr4: 28700079-28700137 [+] UCSC Ensembl
Mir-430-o1b4 chr4: 28700810-28700868 [+] UCSC Ensembl
Mir-430-o3a15 chr4: 28700969-28701027 [+] UCSC Ensembl
Mir-430-o2c2 chr4: 28701230-28701288 [+] UCSC Ensembl
Mir-430-o1c chr4: 28701436-28701494 [+] UCSC Ensembl
Mir-430-o3a14 chr4: 28701595-28701653 [+] UCSC Ensembl
Mir-430-o2a7 chr4: 28701856-28701914 [+] UCSC Ensembl
Mir-430-o1e2 chr4: 28702062-28702121 [+] UCSC Ensembl
Mir-430-o3a13 chr4: 28702221-28702279 [+] UCSC Ensembl
Mir-430-o2a14 chr4: 28702468-28702526 [+] UCSC Ensembl
Mir-430-o1b7 chr4: 28703199-28703257 [+] UCSC Ensembl
Mir-430-o1b8 chr4: 28703199-28703257 [+] UCSC Ensembl
Mir-430-o2a13 chr4: 28703619-28703677 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40          50        
GCCCUUGUGAUAGAAAAC--    U      A          --|    U      UUUAA 
CACCUGUCUCCACUGAAUCA    U      A          CU^    -      CGAGA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence


MirBase accessionMIMAT0031928
Get sequence
Mature sequence


MirBase accessionMIMAT0001424
Get sequence
Seed sequenceAAGUGCU
Validated targets TargetScanFish: dre-miR-430b