MirGeneDB

Gene name

Dre-Mir-24-P3a

Family name MIR-24 (all species)
MiRBase ID dre-mir-24-4
Paralogues Dre-Mir-24-P1  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Dre-Mir-24-P3b 
Orthologues
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr22: 5307502-5307561 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P3a)
Mir-27-P3a chr22: 5299972-5300035 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGAAACACGACUGAGGGCUGUUCCCACUUGUGCCUGCUAAACUGGUAUCAGUAUGUUGAUUUAGUGCUGGCUCAGUUCAGCAGGAACAGGUGUGAAGUCCUCUACUCUCCUCCAAUCAG
Get precursor sequence
Structure
        10        20          30        40        50          
GAGAAACACGACUGAGGGCUG--|  C       G      A      UA     AUGUUG 
                       UUC CACUUGU CCUGCU AACUGG  UCAGU      \
                       AAG GUGGACA GGACGA UUGACU  GGUCG      A
GACUAACCUCCUCUCAUCUCCUG^  U       A      C      C-     UGAUUU 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-24-P3a_5p*

MirBase accessionNone
Sequence
0- GUGCCUGCUAAACUGGUAUCAGU -23
Get sequence
Mature sequence

Dre-Mir-24-P3a_3p

MirBase accessionMIMAT0001792
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
Seed sequenceGGCUCAG
Validated targets TargetScanFish: dre-miR-24