MirGeneDB

MirGeneDB ID

Dre-Mir-218-P1

Family name MIR-218 (all species)
Seed UGUGCUU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-218a-2
Paralogues Dre-Mir-218-P2-v1  Dre-Mir-218-P2-v2  Dre-Mir-218-P3 
Orthologues Aca-Mir-218-P1  Ami-Mir-218-P1  Bta-Mir-218-P1  Cfa-Mir-218-P1  Cli-Mir-218-P1  Cpi-Mir-218-P1  Cpo-Mir-218-P1  Dno-Mir-218-P1  Ete-Mir-218-P1  Gga-Mir-218-P1  Hsa-Mir-218-P1  Mdo-Mir-218-P1  Mml-Mir-218-P1  Mmu-Mir-218-P1  Oan-Mir-218-P1  Ocu-Mir-218-P1  Rno-Mir-218-P1  Sha-Mir-218-P1  Sto-Mir-218-P1  Tgu-Mir-218-P1  Xtr-Mir-218-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr1: 23866891-23866954 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUGUGGAGGAAAUUCAGCGGGGUUUUCCUUUGUGCUUGAUCUAACCAUGUGGUUGCAGACUCAGACUAAUACAUGGUUCUGUCAAGCACCAUGGAAGGUCUUGCAGCAUCUACAGCAUGGCAA
Get precursor sequence
Structure
        10          20        30        40        50        60 
CUUGUGGAGGAAAUUCA--|    GU     UUU         CU         GUUGCAGA 
                   GCGGG  UUUCC   GUGCUUGAU  AACCAUGUG        C
                   CGUUC  GAAGG   CACGAACUG  UUGGUACAU        U
AACGGUACGACAUCUACGA^    UG     UAC         UC         AAUCAGAC 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a range of Dicer cuts ranging from -1 to +4 relative to what is annotated here but this represents the highest mature form across vertebrates.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-218-P1_5p

MirBase accessionMIMAT0001868
Sequence
0- UUGUGCUUGAUCUAACCAUGUG -22
Get sequence
Validated targets TargetScanFish: dre-miR-218a
Star sequence

Dre-Mir-218-P1_3p*

MirBase accessionNone
Sequence
42- CAUGGUUCUGUCAAGCACCAUG -64
Get sequence