MirGeneDB

Gene name

Dre-Mir-216-P1a

Family name MIR-216 (all species)
MiRBase ID dre-mir-216a
Paralogues Dre-Mir-216-P1b 
Orthologues Aca-Mir-216-P1a  Ami-Mir-216-P1a  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cpi-Mir-216-P1a  Cpo-Mir-216-P1a  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dpu-Mir-216-P1  Efe-Mir-216-P1  Ete-Mir-216-P1a  Gga-Mir-216-P1a  Hsa-Mir-216-P1a  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mml-Mir-216-P1a  Mmu-Mir-216-P1a  Ocu-Mir-216-P1a  Rno-Mir-216-P1a  Sha-Mir-216-P1a  Tca-Mir-216-P1  Xtr-Mir-216-P1a 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(danRer10)
chr22: 28830834-28830896 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1a)
Mir-217-P1-v1 chr22: 28830603-28830661 [-] UCSC Ensembl
Mir-217-P1-v2 chr22: 28830603-28830662 [-] UCSC Ensembl
Mir-216-P1b chr22: 28831138-28831196 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACCUGCUAUUGAGCAGCUGAUUUUUGGCAUAAUCUCAGCUGGCAACUGUGAGUAGUGUUUUCAUCCCUCUCACAGGCGCUGCUGGGGUUCUGUCACACACAGCACCUGCAAAACAAGACAAA
Get precursor sequence
Structure
        10           20        30        40        50        60 
AACCUGCUAUUGAGCAG---|  AUUUU     U         U   AA       UAGUGUU 
                    CUG     UGGCA AAUCUCAGC GGC  CUGUGAG       U
                    GAC     ACUGU UUGGGGUCG UCG  GACACUC       U
AAACAGAACAAAACGUCCAC^  ACAC-     C         -   CG       UCCCUAC 
 120       110       100         90         80        70
Deep sequencing
Go to detailed chart
CommentThis gene was named Mir-216-P1 in MirGene 1.0 but it appears that there are two ancestral copies of Mir-216 with the second copy found only in protostomes and the two copies in vertebrates a vertebrate-specific gene duplication of one of these two ancestral paralogues.
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-216-P1a_5p

MirBase accessionMIMAT0001284
Sequence
0- UAAUCUCAGCUGGCAACUGUGAG -23
Get sequence
Seed sequenceAAUCUCA
Validated targets TargetScanFish: dre-miR-216a
Star sequence

Dre-Mir-216-P1a_3p*

MirBase accessionNone
Sequence
41- CACAGGCGCUGCUGGGGUUCUG -63
Get sequence