MirGeneDB

Gene name

Dre-Mir-203-P2-v1

Family name MIR-203 (all species)
MiRBase ID dre-mir-203b
Paralogues Dre-Mir-203-P1-v1  Dre-Mir-203-P1-v2  Dre-Mir-203-P2-v2 
Orthologues
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr17: 45808184-45808243 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-203-P2-v1)
Mir-203-P1-v1 chr17: 45808184-45808243 [+] UCSC Ensembl
Mir-203-P1-v2 chr17: 45808184-45808243 [+] UCSC Ensembl
Mir-203-P2-v2 chr17: 45808184-45808243 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUUGGGUCUCUUCUGGUCCCUCUGGUGCAGUGGUUCUUAACAGUUCAACAGUUCUAUCUCAAAAUUGUGAAAUGUUUAGGACCACUUGACCAGAGUGACACUGUCUCUGAUUCUCAGA
Get precursor sequence
Structure
        10          20        30        40        50          
UGUUUGGGUCUCUUCUG--|  C       GC         U    G    A  GUUCUAU 
                   GUC CUCUGGU  AGUGGUUCU AACA UUCA CA       \
                   CAG GAGACCA  UCACCAGGA UUGU AAGU GU       C
AGACUCUUAGUCUCUGUCA^  U       GU         U    A    -  UAAAACU 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-203-P2-v1_5p*

MirBase accessionMIMAT0003407
Sequence
0- AGUGGUUCUUAACAGUUCAACA -22
Get sequence
Mature sequence

Dre-Mir-203-P2-v1_3p

MirBase accessionMIMAT0001865
Sequence
38- GUGAAAUGUUUAGGACCACUUG -60
Get sequence
Seed sequenceUGAAAUG
Validated targets TargetScanFish: dre-miR-203b