MirGeneDB

MirGeneDB ID

Dre-Mir-199-P1-v1

Family name MIR-199 (all species)
Seed CAGUAGU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-199-2
Paralogues Dre-Mir-199-P1-v2  Dre-Mir-199-P1-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2  Dre-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P1-v1  Aca-Mir-199-P1-v2  Aca-Mir-199-P1-v3  Ami-Mir-199-P1-v1  Ami-Mir-199-P1-v2  Ami-Mir-199-P1-v3  Bta-Mir-199-P1-v1  Bta-Mir-199-P1-v2  Bta-Mir-199-P1-v3  Cfa-Mir-199-P1-v1  Cfa-Mir-199-P1-v2  Cfa-Mir-199-P1-v3  Cli-Mir-199-P1-v1  Cli-Mir-199-P1-v2  Cli-Mir-199-P1-v3  Cpi-Mir-199-P1-v1  Cpi-Mir-199-P1-v2  Cpi-Mir-199-P1-v3  Cpo-Mir-199-P1-v1  Cpo-Mir-199-P1-v2  Cpo-Mir-199-P1-v3  Dno-Mir-199-P1-v1  Dno-Mir-199-P1-v2  Dno-Mir-199-P1-v3  Ete-Mir-199-P1-v1  Ete-Mir-199-P1-v2  Ete-Mir-199-P1-v3  Gga-Mir-199-P1-v1  Gga-Mir-199-P1-v2  Gga-Mir-199-P1-v3  Hsa-Mir-199-P1-v1  Hsa-Mir-199-P1-v2  Hsa-Mir-199-P1-v3  Mdo-Mir-199-P1-v1  Mdo-Mir-199-P1-v2  Mdo-Mir-199-P1-v3  Mml-Mir-199-P1-v1  Mml-Mir-199-P1-v2  Mml-Mir-199-P1-v3  Mmu-Mir-199-P1-v1  Mmu-Mir-199-P1-v2  Mmu-Mir-199-P1-v3  Oan-Mir-199-P1-v1  Oan-Mir-199-P1-v2  Oan-Mir-199-P1-v3  Ocu-Mir-199-P1-v1  Ocu-Mir-199-P1-v2  Ocu-Mir-199-P1-v3  Rno-Mir-199-P1-v1  Rno-Mir-199-P1-v2  Rno-Mir-199-P1-v3  Sha-Mir-199-P1-v1  Sha-Mir-199-P1-v2  Sha-Mir-199-P1-v3  Sto-Mir-199-P1-v1  Sto-Mir-199-P1-v2  Sto-Mir-199-P1-v3  Tgu-Mir-199-P1-v1  Tgu-Mir-199-P1-v2  Tgu-Mir-199-P1-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr5: 1376779-1376839 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P1-v1)
Mir-199-P1-v1 chr5: 1376779-1376839 [-] UCSC Ensembl
Mir-199-P1-v2 chr5: 1376779-1376839 [-] UCSC Ensembl
Mir-199-P1-v3 chr5: 1376779-1376839 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGAGUUUUUGUGGACGCCCGUCCCGCCUGCCCAGUGUUCAGACUACCUGUUCAGGAAUUAGUGUUUGUACAGUAGUCUGCACAUUGGUUAGGCUGGAUGGGGAUGCUCGAGGUGGACUGC
Get precursor sequence
Structure
        10          20        30        40        50        60
UGGAGUUUUUGUGGACG--|      C     C       U        C   U AGGAAU 
                   CCCGUCC GCCUG CCAGUGU CAGACUAC UGU C      U
                   GGGUAGG CGGAU GGUUACA GUCUGAUG ACA G      A
CGUCAGGUGGAGCUCGUAG^      U     U       C        -   U UUUGUG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-199-P1-v1_5p*

MirBase accessionMIMAT0001277
Sequence
0- CCCAGUGUUCAGACUACCUGUUC -23
Get sequence
Validated targets TargetScanFish: dre-miR-199
Mature sequence

Dre-Mir-199-P1-v1_3p

MirBase accessionMIMAT0003155
Sequence
39- ACAGUAGUCUGCACAUUGGUUA -61
Get sequence