MirGeneDB

Gene name

Dre-Mir-196-P3b

Family name MIR-196 (all species)
MiRBase ID dre-mir-196d
Paralogues Dre-Mir-196-P1  Dre-Mir-196-P2a  Dre-Mir-196-P2b  Dre-Mir-196-P3a 
Orthologues Aca-Mir-196-P3  Ami-Mir-196-P3  Bta-Mir-196-P3  Cfa-Mir-196-P3  Cin-Mir-196  Cli-Mir-196-P3  Cpi-Mir-196-P3  Cpo-Mir-196-P3  Dno-Mir-196-P3  Ete-Mir-196-P3  Hsa-Mir-196-P3  Mdo-Mir-196-P3  Mml-Mir-196-P3  Mmu-Mir-196-P3  Ocu-Mir-196-P3  Sha-Mir-196-P3  Tgu-Mir-196-P3  Xtr-Mir-196-P3 
Node of Origin (gene) Teleostei
Node of Origin (family) Olfactores
Genome context
(danRer11_plustraces)
chr16: 20913420-20913478 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAAGAAACAAAGACAACUGCUAAGUGAUUUAGGUAGUUUUAUGUUGUUGGGCUCUAUUUUAUAUCCCCGCAACACGAAACUGUCUUAAUUGCCUCGCAGUGAGAUUCAGCACAACAAG
Get precursor sequence
Structure
        10          20        30        40        50         
CCAAGAAACAAAGACAA--|   UAA UG   U  GU     UA      U   CUCUAU 
                   CUGC   G  AUU AG  AGUUU  UGUUGU GGG      \
                   GACG   C  UAA UC  UCAAA  ACAACG CCC      U
GAACAACACGACUUAGAGU^   CUC GU   U  UG     GC      C   UAUAUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-196-P3b_5p

MirBase accessionMIMAT0011313
Sequence
0- UAGGUAGUUUUAUGUUGUUGGG -22
Get sequence
Seed sequenceAGGUAGU
Validated targets TargetScanFish: dre-miR-196d
Star sequence

Dre-Mir-196-P3b_3p*

MirBase accessionNone
Sequence
37- CCGCAACACGAAACUGUCUUAA -59
Get sequence