MirGeneDB

Gene name

Dre-Mir-193-P1a2

Family name MIR-193 (all species)
MiRBase ID dre-mir-193a-2
Paralogues Dre-Mir-193-P1a1  Dre-Mir-193-P1b  Dre-Mir-193-P2a1  Dre-Mir-193-P2a2  Dre-Mir-193-P2b1 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Bge-Mir-193-P1  Bta-Mir-193-P1a  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cgi-Mir-193-P1  Cpi-Mir-193-P1a  Cpo-Mir-193-P1a  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dpu-Mir-193-P1  Ete-Mir-193-P1a  Gga-Mir-193-P1a  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mml-Mir-193-P1a  Mmu-Mir-193-P1a  Ocu-Mir-193-P1a  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Sha-Mir-193-P1a  Tca-Mir-193-P1  Tgu-Mir-193-P1a 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(danRer11_plustraces)
chr6: 18517992-18518050 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1a2)
Mir-193-P2a2 chr6: 18516330-18516391 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAGUAACACUUGAGAGUGUGUCAGAGGCUGGGUCUUUGCGGGCAAGGUGAGUUUUCCUUUCAUUCAACUGGCCUACAAAGUCCCAGUUUUCGGCCCAUGUGACCAUCUCUGUCAAUU
Get precursor sequence
Structure
        10          20        30        40        50         
UUCAGUAACACUUGAGA--|  U   AG        U     CG   A  G   GUUUUC 
                   GUG GUC  AGGCUGGG CUUUG  GGC AG UGA      \
                   UAC CGG  UUUGACCC GAAAC  CCG UC ACU      C
UUAACUGUCUCUACCAGUG^  C   CU        U     AU   G  A   UACUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-193-P1a2_5p*

MirBase accessionMIMAT0031981
Sequence
0- UGGGUCUUUGCGGGCAAGGUGA -22
Get sequence
Mature sequence

Dre-Mir-193-P1a2_3p

MirBase accessionMIMAT0001856
Sequence
37- AACUGGCCUACAAAGUCCCAGU -59
Get sequence
Seed sequenceACUGGCC
Validated targets TargetScanFish: dre-miR-193a