MirGeneDB

Gene name

Dre-Mir-148-P1

Family name MIR-148 (all species)
MiRBase ID dre-mir-148
Paralogues Dre-Mir-148-P3 
Orthologues Aca-Mir-148-P1  Bta-Mir-148-P1  Cfa-Mir-148-P1  Cli-Mir-148-P1  Cpi-Mir-148-P1  Cpo-Mir-148-P1  Dno-Mir-148-P1  Ete-Mir-148-P1  Gga-Mir-148-P1  Hsa-Mir-148-P1  Mdo-Mir-148-P1  Mml-Mir-148-P1  Mmu-Mir-148-P1  Ocu-Mir-148-P1  Rno-Mir-148-P1  Tgu-Mir-148-P1  Xtr-Mir-148-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr9: 1644693-1644750 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUCAAGCAGCUCUCUGGCUUUCCAAGUAAAGUUCUGUGAUACACUCCGACUCUGAAUGUUUGCAGUCAGUGCAUUACAGAACUUUGUUUUGGGAGUUUAAAGCUCAGGCCUGGAGG
Get precursor sequence
Structure
        10          20        30        40        50         
UCAUCAAGCAGCUCUCU--|   UU C                 A    CC    CUGAA 
                   GGCU  C AAGUAAAGUUCUGUGAU CACU  GACU     U
                   UUGA  G UUUGUUUCAAGACAUUA GUGA  CUGA     G
GGAGGUCCGGACUCGAAAU^   GG U                 C    --    CGUUU 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-148-P1_5p*

MirBase accessionNone
Sequence
0- AAGUUCUGUGAUACACUCCGACU -23
Get sequence
Mature sequence

Dre-Mir-148-P1_3p

MirBase accessionMIMAT0001845
Sequence
37- UCAGUGCAUUACAGAACUUUG -58
Get sequence
Seed sequenceCAGUGCA
Validated targets TargetScanFish: dre-miR-148