MirGeneDB

Gene name

Dre-Mir-146-P1-v1

Family name MIR-146 (all species)
MiRBase ID dre-mir-146b
Paralogues Dre-Mir-146-P1-v2  Dre-Mir-146-P2 
Orthologues Ami-Mir-146-P1  Bta-Mir-146-P1-v1  Bta-Mir-146-P1-v2  Cfa-Mir-146-P1  Cli-Mir-146-P1  Cpi-Mir-146-P1  Cpo-Mir-146-P1  Dno-Mir-146-P1  Gga-Mir-146-P1  Hsa-Mir-146-P1  Mdo-Mir-146-P1  Mml-Mir-146-P1  Mmu-Mir-146-P1  Ocu-Mir-146-P1  Rno-Mir-146-P1  Sha-Mir-146-P1  Tgu-Mir-146-P1  Xtr-Mir-146-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr21: 41639990-41640048 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-146-P1-v1)
Mir-146-P1-v2 chr21: 41639989-41640049 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCUGGAUGUUACACUGAGCUCUUGGCUUUGAGAACUGAAUUCCAAGGGUGUCUGCUUUAUAUUCAGCCCACGGAGUUCAGUUCUUAAGUUUGGAUGCUCACGGCCGUCUGAACACAC
Get precursor sequence
Structure
        10         20         30        40        50         
CUUCUGGAUGUUACACU-    -|  UG    U              AA    GUCUGCU 
                  GAGC UCU  GCUU GAGAACUGAAUUCC  GGGU       U
                  CUCG AGG  UGAA UUCUUGACUUGAGG  CCCG       U
CACACAAGUCUGCCGGCA    U^  UU    -              CA    ACUUAUA 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-146-P1-v1_5p

MirBase accessionMIMAT0001844
Sequence
0- UGAGAACUGAAUUCCAAGGGUGU -23
Get sequence
Seed sequenceGAGAACU
Validated targets TargetScanFish: dre-miR-146b
Star sequence

Dre-Mir-146-P1-v1_3p*

MirBase accessionNone
Sequence
38- CCCACGGAGUUCAGUUCUUAA -59
Get sequence