MirGeneDB

MirGeneDB ID

Dre-Mir-133-P3b-v2

Family name MIR-133 (all species)
Seed UGGUCCC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-133c
Paralogues Dre-Mir-133-P1-v1  Dre-Mir-133-P1-v2  Dre-Mir-133-P2-v1  Dre-Mir-133-P2-v2  Dre-Mir-133-P3a-v1  Dre-Mir-133-P3a-v2  Dre-Mir-133-P3b-v1 
Orthologues Aae-Mir-133  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Ami-Mir-133-P3-v1  Ami-Mir-133-P3-v2  Asu-Mir-133  Bge-Mir-133  Bta-Mir-133-P3-v1  Bta-Mir-133-P3-v2  Cbr-Mir-133  Cel-Mir-133  Cfa-Mir-133-P3-v1  Cfa-Mir-133-P3-v2  Cin-Mir-133  Cli-Mir-133-P3-v1  Cli-Mir-133-P3-v2  Cpi-Mir-133-P3-v1  Cpi-Mir-133-P3-v2  Cpo-Mir-133-P3-v1  Cpo-Mir-133-P3-v2  Cte-Mir-133  Dan-Mir-133  Dme-Mir-133  Dmo-Mir-133  Dno-Mir-133-P3-v1  Dno-Mir-133-P3-v2  Dpu-Mir-133  Efe-Mir-133  Ete-Mir-133-P3-v1  Ete-Mir-133-P3-v2  Gga-Mir-133-P3-v1  Gga-Mir-133-P3-v2  Hme-Mir-133  Hsa-Mir-133-P3-v1  Hsa-Mir-133-P3-v2  Isc-Mir-133  Lan-Mir-133  Lgi-Mir-133  Mdo-Mir-133-P3-v1  Mdo-Mir-133-P3-v2  Mml-Mir-133-P3-v1  Mml-Mir-133-P3-v2  Mmu-Mir-133-P3-v1  Mmu-Mir-133-P3-v2  Oan-Mir-133-P3-v1  Oan-Mir-133-P3-v2  Ocu-Mir-133-P3-v1  Ocu-Mir-133-P3-v2  Rno-Mir-133-P3-v1  Rno-Mir-133-P3-v2  Sha-Mir-133-P3-v1  Sha-Mir-133-P3-v2  Spu-Mir-133  Tca-Mir-133  Tgu-Mir-133-P3-v1  Tgu-Mir-133-P3-v2  Xtr-Mir-133-P3-v1  Xtr-Mir-133-P3-v2 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr17: 5962990-5963049 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-133-P3b-v2)
Mir-133-P3b-v1 chr17: 5962990-5963049 [-] UCSC Ensembl
Mir-133-P3b-v2 chr17: 5962990-5963049 [-] UCSC Ensembl
Mir-1-P3b chr17: 5967262-5967321 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCGUCAGUCUUCAGAAACACGGCUUAGUUGCUGGUAAAACGGAACCAAGUCGGGUGUUUGCGAGAGGUUUGGUCCCUUUCAACCAGCUACUGCGCCGUGAAUUCAGCCUGCAACACUGA
Get precursor sequence
Structure
        10          20        30        40        50         
CUCGUCAGUCUUCAGAAA--|     U    U      AA  C  A       CGGGUGU 
                    CACGGC UAGU GCUGGU  AA GG ACCAAGU       U
                    GUGCCG GUCA CGACCA  UU CC UGGUUUG       U
AGUCACAACGUCCGACUUAA^     C    U      AC  U  C       GAGAGCG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-133-P3b-v2_5p*

MirBase accessionMIMAT0031971
Sequence
0- GCUGGUAAAACGGAACCAAGU -21
Get sequence
Mature sequence

Dre-Mir-133-P3b-v2_3p

MirBase accessionMIMAT0001832
Sequence
39- UUGGUCCCUUUCAACCAGCUA -60
Get sequence
Validated targets TargetScanFish: dre-miR-133c