MirGeneDB

Gene name

Dre-Mir-132-P2b

Family name MIR-132 (all species)
MiRBase ID dre-mir-212-2
Paralogues Dre-Mir-132-P1a  Dre-Mir-132-P1b  Dre-Mir-132-P2a 
Orthologues Aca-Mir-132-P2  Ami-Mir-132-P2  Bta-Mir-132-P2  Cfa-Mir-132-P2  Cpi-Mir-132-P2  Cpo-Mir-132-P2  Dno-Mir-132-P2  Hsa-Mir-132-P2  Mdo-Mir-132-P2  Mml-Mir-132-P2  Mmu-Mir-132-P2  Ocu-Mir-132-P2  Rno-Mir-132-P2  Sha-Mir-132-P2  Xtr-Mir-132-P2 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr10: 35644719-35644787 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-132-P2b)
Mir-132-P1b chr10: 35645043-35645103 [+] UCSC Ensembl
Mir-2184-P1 chr10: 35654276-35654332 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGUCUUUUCAAGCAUGUCAGAACUUCAUGACCUUGGCUCUAGACUGCUUACUGCUUAUGGAGUCCGACAGUACAGUAACAGUCUACAGUCAUGGCUACUGAAGUCUGGCUCCAGCAUCACACACUAAU
Get precursor sequence
Structure
        10           20         30        40        50        60    
GAGUCUUUUCAAGCAUG---|    A     -  A  U     C       C     GCUUAUGGAG 
                    UCAGA CUUCA UG CC UGGCU UAGACUG UUACU          \
                    GGUCU GAAGU AU GG ACUGA AUCUGAC AAUGA          U
UAAUCACACACUACGACCUC^    -     C  C  U     C       -     CAUGACAGCC 
       120       110        100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-132-P2b_5p

MirBase accessionMIMAT0048650
Sequence
0- ACCUUGGCUCUAGACUGCUUACU -23
Get sequence
Seed sequenceCCUUGGC
Co-mature sequence

Dre-Mir-132-P2b_3p

MirBase accessionMIMAT0048651
Sequence
46- UAACAGUCUACAGUCAUGGCUAC -69
Get sequence
Seed sequenceAACAGUC