MirGeneDB

MirGeneDB ID

Dre-Mir-126-P2-v2

Family name MIR-126 (all species)
Seed CGUACCG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-126b
Paralogues Dre-Mir-126-P1-v1  Dre-Mir-126-P1-v2  Dre-Mir-126-P1-v3  Dre-Mir-126-P2-v1  Dre-Mir-126-P2-v3 
Orthologues
Node of Origin (locus) D. rerio
Node of Origin (family) Olfactores
Genome context
(danRer11)
chr21: 7240249-7240307 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-P2-v2)
Mir-126-P2-v1 chr21: 7240249-7240307 [-] UCSC Ensembl
Mir-126-P2-v2 chr21: 7240249-7240307 [-] UCSC Ensembl
Mir-126-P2-v3 chr21: 7240249-7240307 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGAUUUGAGUCUUACCGGCCUCACGGUUCAUUAUUACUUUUGGUACGCGCUAUGCCACUCUCAACUCGUACCGUGAGUAAUAGUGCACUGUGACUGGUGAACACAACUAUAACCUAC
Get precursor sequence
Structure
        10        20          30        40        50         
GGAGAUUUGAGUCUUACCG   --|      U           U       CGCUAUGCC 
                   GCC  UCACGGU CAUUAUUACUU UGGUACG         \
                   UGG  AGUGUCA GUGAUAAUGAG GCCAUGC         A
CAUCCAAUAUCAACACAAG   UC^      C           U       UCAACUCUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-126-P2-v2_5p*

MirBase accessionMIMAT0011307
Sequence
0- CAUUAUUACUUUUGGUACGCGC -22
Get sequence
Mature sequence

Dre-Mir-126-P2-v2_3p

MirBase accessionMIMAT0011306
Sequence
37- UCGUACCGUGAGUAAUAGUGCA -59
Get sequence
Validated targets TargetScanFish: dre-miR-126b