MirGeneDB

Gene name

Dre-Mir-124-P2a-v2

Family name MIR-124 (all species)
MiRBase ID dre-mir-124-1
Paralogues Dre-Mir-124-P1-v1  Dre-Mir-124-P1-v2  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Dre-Mir-124-P3a-v1  Dre-Mir-124-P3a-v2  Dre-Mir-124-P3b-v1  Dre-Mir-124-P3b-v2  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P2-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Cel-Mir-124  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cli-Mir-124-P2-v1  Cli-Mir-124-P2-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dpu-Mir-124  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Hme-Mir-124  Hsa-Mir-124-P2-v1  Hsa-Mir-124-P2-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P2-v1  Rno-Mir-124-P2-v2  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(danRer11_plustraces)
chr2: 26645328-26645385 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P2a-v2)
Mir-124-P2a-v1 chr2: 26645327-26645385 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCUGUUUGCAUUUUAGGCUCUCGCUGUACGUGUUCACAGUGGACCUUGAUUUAUUGUAUUUCAAUUAAGGCACGCGGUGAAUGCCAACAGCACAGCCAUUUACACUUCAGCAAAUA
Get precursor sequence
Structure
        10          20        30        40        50         
UUUCUGUUUGCAUUUUA--|   CUC     AC        A   GA        UAUUG 
                   GGCU   GCUGU  GUGUUCAC GUG  CCUUGAUU     \
                   CCGA   CGACA  CGUAAGUG CGC  GGAAUUAA     U
AUAAACGACUUCACAUUUA^   CA-     AC        G   AC        CUUUA 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-124-P2a-v2_5p*

MirBase accessionNone
Sequence
0- CGUGUUCACAGUGGACCUUGAUU -23
Get sequence
Mature sequence

Dre-Mir-124-P2a-v2_3p

MirBase accessionMIMAT0001819
Sequence
36- UUAAGGCACGCGGUGAAUGCCA -58
Get sequence
Seed sequenceUAAGGCA
Validated targets TargetScanFish: dre-miR-124