MirGeneDB

MirGeneDB ID

Dre-Mir-10-P3a1

Family name MIR-10 (all species)
Seed CCCUGAG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-125b-1
Paralogues Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Dre-Mir-10-P1b1-v1  Dre-Mir-10-P1b1-v2  Dre-Mir-10-P1b2-v1  Dre-Mir-10-P1b2-v2  Dre-Mir-10-P1c-v1  Dre-Mir-10-P1c-v2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Dre-Mir-10-P2c1  Dre-Mir-10-P2c2  Dre-Mir-10-P3a2  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Ami-Mir-10-P3a  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Cfa-Mir-10-P3a  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cpi-Mir-10-P3a  Cpo-Mir-10-P3a  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dpu-Mir-10-P3  Ete-Mir-10-P3a  Gga-Mir-10-P3a  Hsa-Mir-10-P3a  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mml-Mir-10-P3a  Mmu-Mir-10-P3a  Oan-Mir-10-P3a  Ocu-Mir-10-P3a  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Sha-Mir-10-P3a  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3a  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Xtr-Mir-10-P3a 
Node of Origin (locus) D. rerio
Node of Origin (family) Eumetazoa
Genome context
(danRer11)
chr15: 21447701-21447762 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P3a1)
Mir-10-P2a1 chr15: 21437656-21437712 [+] UCSC Ensembl
Let-7-P1a1 chr15: 21437886-21437952 [+] UCSC Ensembl
Mir-10-P3a1 chr15: 21447701-21447762 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGUUGGUCUGCAAAUGUGCCUCUCACAAUCCCUGAGACCCUAACUUGUGACGUUUUCCUGUUAUGUGCACGGGUUAGGUUCUUGGGAGCUGAGAGGGGUGCUCUGUCAUCAGCCCGCCGG
Get precursor sequence
Structure
        10          20        30         40        50        60
GCGGUUGGUCUGCAAAU-- UG      A  A-|   U    C           ACGUUUUC 
                   G  CCUCUC CA  UCCC GAGA CCUAACUUGUG        C
                   C  GGGGAG GU  AGGG UUCU GGAUUGGGCAC        U
GGCCGCCCGACUACUGUCU GU      A  CG^   -    U           GUGUAUUG 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-10-P3a1_5p

MirBase accessionMIMAT0001821
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Validated targets TargetScanFish: dre-miR-125b
Star sequence

Dre-Mir-10-P3a1_3p*

MirBase accessionMIMAT0031963
Sequence
40- ACGGGUUAGGUUCUUGGGAGCU -62
Get sequence