MirGeneDB

Gene name

Dre-Mir-10-P3a1

Family name MIR-10 (all species)
MiRBase ID dre-mir-125a-1
Paralogues Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Dre-Mir-10-P1b1-v1  Dre-Mir-10-P1b1-v2  Dre-Mir-10-P1b2-v1  Dre-Mir-10-P1b2-v2  Dre-Mir-10-P1c-v1  Dre-Mir-10-P1c-v2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Dre-Mir-10-P2b1  Dre-Mir-10-P2b2  Dre-Mir-10-P3a2  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Ami-Mir-10-P3a  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Cfa-Mir-10-P3a  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cpi-Mir-10-P3a  Cpo-Mir-10-P3a  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dpu-Mir-10-P3  Ete-Mir-10-P3a  Hsa-Mir-10-P3a  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mml-Mir-10-P3a  Mmu-Mir-10-P3a  Ocu-Mir-10-P3a  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Sha-Mir-10-P3a  Sko-Mir-10-P3  Spu-Mir-10-P3  Tca-Mir-10-P3  Xtr-Mir-10-P3a 
Node of Origin (gene) Teleostei
Node of Origin (family) Eumetazoa
Genome context
(danRer11_plustraces)
chr16: 24898184-24898242 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCUGUUUUUUUACACAGUAUGUCUCUUUGUCCCUGAGACCCUUAACCUGUGAGGUCAAACUAGGUCACAGGUGAGGUCCUCAGGAACAGGGCUGCAUGCGUCGUCAUCCCCAAACGUC
Get precursor sequence
Structure
        10          20        30        40        50         
UCCUGUUUUUUUACACA--|     CU      C      AC     A       GGUCA 
                   GUAUGU  CUUUGU CCUGAG  CCUUA CCUGUGA     A
                   CGUACG  GGGACA GGACUC  GGAGU GGACACU     A
CUGCAAACCCCUACUGCUG^     UC      A      CU     -       GGAUC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-10-P3a1_5p

MirBase accessionMIMAT0001820
Sequence
0- UCCCUGAGACCCUUAACCUGUGA -23
Get sequence
Seed sequenceCCCUGAG
Validated targets TargetScanFish: dre-miR-125a
Star sequence

Dre-Mir-10-P3a1_3p*

MirBase accessionNone
Sequence
37- ACAGGUGAGGUCCUCAGGAACA -59
Get sequence